Description :
From Genome Similarity Track
Location :
contig_38:59484- 64015
Transcript NameFunction/comments
g8689.t1RAW38034.1 hypothetical protein PC110_g5732 [Phytophthora cactorum
g8690.t1POM73604.1 GPI ethanolamine phosphate transferase [Phytophthora palmivora var. palmivora

Sequence
4531 bases(100 bases per row)
GTAAACGACAAAAGCACTCACGCGCAGCAACAAGCAGCTCTCTTCTGCGTAGGAAGTGCACGCACCGCCCCCTTGGCGATCTCAAACGCCGTAGACACCG
TATGTCCATGAAATAGTGACAGGTAGAAATGCTTGGCAAACATCGTCGCCGACGCGTCGACCACCAGTGAATCCGAGTGCACCGCCACGACATGCGGGAT
GCCAGCGTTCAAGAACACCGACGCGACCTTCTGGCTATGACACGCGTTGACAAACACCAGCTGCACATTGCATCCAGCGGTCTGGGCACAGCAGCAGACT
TTCCCGTGGTTTCCATCTCCACAGGCGCAGCCCCCGGCACCTGCTGCTGTCGATCGCCAGAGAACATCAACTGCCTCAACGCGTCCGGGGTGATGAGGTG
CGTGCACCCCGCCCCATCTTCAAAGCAGAGCGCCGCACGCTGACCCAGTCCGTGGCCGGAAAAGTGCAGCACCGTGCACTTCCAGGCCGTCATGAGGCTG
CGCAGAATGTCCGCCGTGGCGATGTCGAAGCGTACGTGGATGGCCTTGTGCTGTACATCTGTAAGCAGCGAGTTGCTGATCTCGCGCCGCTCTGCCTCCA
GGTCCAGCTTCTCCATGGGGTAGATGCGGTGGCGACTGTCCTTGATCACGAGCGGCGCCGCGTGCAGCACCACCAGGTCCAGCGCGTTCTCGTCGCGCGG
CAACCAGTTCGGACTCGGCTGTGACGAGGCAGTTGTTGTTGAAGTTAATGGAGCCGGTGCTGAAGATGACGTAATAGCCTCGCTTGAAGTCGCAATCAGC
GCCTCGAGCGCCTGGGAGAGCCGCACGCGGTCCCCGAACGCCGCGATGCCCAGGTCGTCACGCAGCGCGTTGCGTGTGAGCTCCGGCAGGATGGCGCCCG
AGATCTTGTTGGCGGCGAAGAGCTCCGCGTGCTCGCCGAAGCCCTGCGCGCCCAGCCACTGGCCCACGTCGGCGCACGACCAAGCGCTCCAGGGCGGAGC
CGACATGCTGCCTCCATTTTGAAGTGAAAGTGAGGTAGTCACTAGATCAGCGGGATGAATCCATACTGAAATCAACAAGGCGTGTGTGGAAAAGACTGCG
TTATTAGTATCAGATCTGATTCCAATAGTTGCGGGTTCGGGCCATCCATTAGTGGAGCTGCTCATGGCGACTTCGGCAGGAGGCAAGAAGCGGCCGCGTG
CCGACCTGCTGTCGTCGCTGGACGCCGCGTTCGCGTCTACTGCGCAGCCTACAGCGTCTAAGTACACGACGCAAGCGGCTGCGCAGGCGGCCCAATGGCA
ACAAACAGCAGGCCTACCAGCACTCGAAACGGAAGCGCAAGGGCGGCAAGAACCACGACAAAGCTGGACACGCGCGAGGAAATGGCAGGGAAGCAGCGAA
AGAACAGGAGAATAAGAGCGAGTATAAGGTTGACCCGCTGTATGAGAAGATGGACGCGGAGTTGCTGGCGGTTGGGCTGAAGGACTGCTCGCTGGTGAGG
ACAGAGCTGTTAGGTTTGGTAGTTTTAATGAGGTGCTGACGCGTGCTTCATTTGTGGTTATTGCAGCACCCACAAGCGAAAACCTTGACGAAGTCGCGGG
CATTGCACGAGACATTCAAGAACTATCTGGAGTCGGTGGTGCAGGGAACAAGAGCAGGTTCTACTGCTGTGGCCAGTCTCAAGAACAAGGTGCTGTCCTT
GGACAACCCTTTCAAGACGACAGCAGCGGAGACCTCGGAGAAAGCAATTACGGCGGCAAGCAAGAAGCAGACGGCCAAGCTGCTGAGTGCGAGACGGCGC
AGGGAATTGGGTCTGCATCTGCTTAGCGGGAACATGAAGTACAGCGATGCGATACTGCTCAACGATATCTGGACGAAGTTTGTTCGCCAGATTATTGAAA
GCGAGGTGGGCGTCGTTCAGGACGTAACGGTCGAGGCGCAGCGTACGCGAAACACGAAGCTCCAGGCTAAGCTCAAGTATCTGGATCTTTCCGGGTGTCC
ACTTGAAGGTGCGTTCGGTAGACAGCTGAGTTCCTCGTCATACAACTGGGACTAACAATGCGATCGTTGTTCTTTGCAGTGATTCAATCGCAGAACCCGT
GCAAGGTTGGCCTCAACGGGATCGTCGTCGCGGAGACCCAACACACGGTTCAGATCTGCTGCCTTGCAGCTACCGGAGACGACAAGGACGACGGCCCTAT
TCGCAGTACGTGCACCCACAAGAGTCGAGTCGCCCATGCTCCTCACCCAACCACTTCTTGTCGTTGCTAACACCCACTCTCGTTGGTGTCCACAGCTTTA
GTCAAGTTAGATTCGCGTTTCAAGGTCCGCCTCGACTCCACTCGAACCTGTTCCTCGATGGTGCGTGGTTCGCTGAGCGTGCACAATAGACAGCACTCTC
ATCCGCTTGCTCAATGGCATCACATCCTTGCGCCGTTTGATACACCAAAACCAAATTGTCGTGTATCCATCTCACGAAATAAGAGCATAAATACTCTCTC
TAACCGCTGGCAGTTAACTTTCGTCGATTCGGAGGTCGTTGCTGGCATGGGCAACATCGCTCGCCTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGC
ATCCTCAGCATATTTGACATTCACTTCCAATCGCCCGTGGAGTCCTCGATCCCCAGTAACGAGTACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCT
TCACGCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGCACGCAGACCGCTACGATCTCAATGCGGAGAGCGCCTCGACGAGCACCAA
GTTCGCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGCGGCAGTTGGGGCGTCTCTCACAACCACGCGCCGACTGAGAGTCGACCG
TGCCACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCAAGAACTGGAAGCAGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGA
GCAGTAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATGCTGGCTAGACACGCCCCGCAAGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGT
CGATATAATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAGATGAAGGATTTATTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTG
TACAAGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCACCGACTTGCGGGACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGA
GAATATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGATGCGTACTTTGGAAACGACAGACGAACGGCGTATGTGCTGAATTCAGAC
CATGGAATGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACGCGGACGGCGATCATTGCGTGGGGGGCAGGTATCCACCGTCCTGTTGTGG
TGAATAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTAAAGCTGAGGTGCAGGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGT
TGCAGCACAAGAATGGAGAACGCTAATAATTTCAAGCGCAAGGATGTGATGCAGATAGACGTTGCACCACTCATTAGTGCGCTAGCAGGGCTTCCATATC
CTCGAAACTCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAGTATCGTGTGAATGCCATGCGCGCCAATGCACAGCAGCTGTACCAGCATGC
ATTGCGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTCCCTACGCACCACTTCACAGCCGTGTGCCAGATCTGATGGCCCATATTGAC
GAAGCCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCACAACGAGGCACACCATGTCATCGAAAATTGATCCAGGAGATGATCGATAT
CTGCCGGAATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTGCTAGGATCAGTCATTCTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTT
GCCTATTTACAGCCCCAAAAATTCCGAGTGTCGTGGCTGTTGGTCCACATGATTGATGTAAAGTTTGTTGCTGCTGTGTAGTAGTGATGTGGTGGCGCTT
TTTCGCCAACTCGCCATCGACATACTATCTGTATGGACTGTGTCCTCTTATCTTATGGAATTTCGTTTGGAACTATCGCGATAAACTCAAAGCTGCACTC
CCTCTTGCTCAAGATTTTGGGTGGCAGCAGAGTGTTGAGATTGCAGCAATATTTTTGTGTCTGGAGCAAGTTGTCCTTGGTTATCAACACCGAGCCATAT
TCAGCTTATTGTTCCTTCTGCTTGCGTTGAGGCCGAGAATTGCAGTTGGGCACGTTCGAGAACCAACCCGTGGACTGTACCAAAGAGACGGTGGGAGAAA
GTTGACGTCGCCAACTTTCTGGTGGTCTGCT