Description :
From Genome Similarity Track
Location :
Scaffold_191:5946- 7355
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_191-fgenesh-gene-0.1Secretory protein OPEL

Sequence
1409 bases(100 bases per row)
TCATTCATCACTATGAAGGTCTATGGCTTCCTCCGCGCGGCCATGCTCTCGGCCGTGATTCTCGGTGCCGCCACCTCCGTCGACGCGCGCAAGGCCGGCA
AGACGCTCTGCGACGCCGACATCCCGGCCGCGCCAGCGTCCAACCCGGGACTCAAGGGTAGCACGATGACCAAGCCAGCGCCAGTGATTCCAGTGATCAA
GGGCAAGCTCCCCGTCGTGGCTACGCCAGTGCCAGTCGTGGCTGTCACCCCTGTGGCGCCTGCCCCAGCTCCTGCTGCGCCACCAGCTGCGCCAGTCAAC
GCTGGCGGTGCCGGATCGATTCCAGCTCCTGCCGCCCCTGGCAAAGACACTGTGGTGGACGGAGCCGCNNNNNNNNNNNNNNNNNNNGGTGGGTCCTGCC
AAGGAAGAGCCTGCGGCGACCCCTGCTCCAGCTCCAGCGTCGACCCCTGCGGCCGCCACCCCATCAGGTGCCGCGCAGACCAAGACCGGCACTGTCAAGG
CCAAGTTCTCGTACACTGGCAAGGACGCCGGCGGTCCGGGCTTCTATGACATGGTCACGGACTTTGCGACGTGCGCCAAGACCAAGCAGGCTACGTCGAG
CCCAGTGTCCCCACTGGACGACGACGTCACAATTGTGTTCCGCGGTCCAATGAACATCTACAACATCGCTGTGTTCGACGGCTCGAGCGGCTCGTGGAAC
AAGGTGTCGTCCTACGAGAAGGGCGGCGCTGCCAACAACTTGGTGTTCCTCAACAACCGCAACATCGACTACAACGGCAAGAGCTCGCCACAGGGTTTCT
CGAACGAAGACGGCACCAAATCCGTCGCGCAGTCGACTCCGTTCAAGGGAGCCCTGGCTGCTGCCTCGAACCCGTACAGCCAGTCGATCTACGCGGACGA
GAAGACCGGTGCGGAGGTGCACATCATGTCGGGCAAGAAGTGCGGTCAGGACGGTGAGTGCAAGGGCTACTACGACAAGGACGGCACGGCTTTCCACGGC
TGGGGTGGCGCAAAGAAGATGTTTGTGACCAAGGTTAACATGCCACAGGGCGGCAGCCCAAACCTTCCAGCCATCTGGATGCTCAACGCGCAGATCGTGC
GCTCGAGCCAGTACCAGTGCAACTGCCGCGGCATGGGCAAGGGCGGCGGCTGCGGTGAGCTCGACATCGCCGAGGTCATCGAGAAGGACACGACCGTCGT
GGCGACCCACTACTACTTCTACGACGGCGGCTCGGCCCCAGGCCACGACTCGTTCGGCAAGCGCCCTTACGACACTCCAGCTACGTACATCACGATCATC
GACGAGTCGTACGGCGTCAAGATCCTGGAACTCGGCCCAGACGACTTTGACTTCTCCTGCGGAAGCGTCTCGAACGACGTCATCTCACAGTGGCTGAAGG
CGTAAACAG