Description :
From Genome Similarity Track
Location :
Scaffold_863:5944- 8205
Transcript NameFunction/comments
Phypl_g11342aspartate-semialdehyde dehydrogenase, putative
Phypl_g113433,2-trans-enoyl-CoA isomerase, mitochondrial precursor

Sequence
2261 bases(100 bases per row)
gagcgcgaggacgcgaacagcaccagctgcgaGACCGGGAACTTGTGCGCGGCTAGCACCGAGATGATCTCGATGCCCACGGCGCCTGTGGCGCCGCAGA
TGCCgaccttcttgccgctgggcgtcgtcatTGCACTGATCCGATGGACAGGAAATGCGGTTGTGCCACGGATGGCGGCCGCGGTTGCTCAAACAAAATC
TTGTGGCGGGTGACGCGCTGTCGTGACGCGTCGTGATGTCGTACTTAACCGGATGCATACAGTAGATAAATATTGAAGTTGGTCTTCACGACGGAATCCC
AAGATCCAGCGCAGTACCCGAGAGACCCCCCTCCGAGCGACGATCATGCTGCCTGTTGCCATCAAgcccgcgctgctgcgtgcgaCGCGCGctttctcct
cgtcgtcgatcgagccgctggtgctggtggagaagaaggacaagtacGCGGTCGTGCGCATGAACCGCCCGCCCGTCAACTCGCTCAGCACGGCGGTGCG
TTGGGTAGCTGCACGCCTTGATGCGCTATATATACCCGTCATAATGTATTCGACGTTGTTACTGTTTGTAGCTGATCCAAGAGCTGAACGCGACCATtaa
gaagctcgaggacgacaagaGCATGCGGTAGGATACCGTGAGGGAGCGGTACATTTGACACCCCCTGGACATTAGTTTTGACGATCCTGTGTGTATGGGG
GTTCTTTAACTTGATACAGCGGCTTCATCCTGGCGTCTTCCAGCCAGAAGGTCTTCTCTGCCGGCCTGGACATCATGGAGATGTACCAACCGCAGGTAGC
AGCACTACGGTACACTCGTACCCGAGCTTGTGTAGCAGTATCTCACCTCCCTATTGCAACCCATGACTGACAGCCCGCCAAGATCACCAAGTTCTGGACG
TCCCTCCAGGATCTGTACCTGCGTCTGTACACGACGCGTCTGGCTACAGTGGCTGCCATTGAGGGACACAGCCCGGCAGGAGGCTGTCTGCTGGCCATGT
GCTGCGACTACCGCATCATGACCAGCGGCAAGCCCATGATCGGCCTCAACGAGACACAGCTGGGTATCGTGGCACCCACGTGGTTCCGCGACACTTTTGT
CAACACGATCGGCCACCGTgaggcggagaagatgctTGGACTCGGACTGCAGGTGGACGCGACCAAAGCGAAGGCGATCGGCTTGGTGGACGAGGCGGTG
GCTCTGGAGGAAGTTTTCCCGCGTGCTGAGGCTGCAATGGGCAAGTGGCTGGCCATTCCGGGTATGGTATTGTTGTTTTTGAAGATGTTGAAATGATTCA
GAAGGGCTAACGGATTACTGTTGTGGTTTTTACGTTTAGACATGGCGCGAGTGAAGACCAAACTGTTGATGCGTCAAGCGACGGCGGACCGACTGTTGGC
CATCCGTGAGAAGGACCTTGAGGCCTTTACGGACTTTGCCCAGACAGACAAGGTGCAGAAATCGCTGGGGATGTACCTTGCTTCACTTACGAAGAAGTGA
TGGGATTTCTAGTGCGCGAGGAGAGCTCATCGCTTATAGCGAGCTGAAACTATGCACGTGCATTTGTGTACAAAGTGTAGTATTTCAAGCTATCACGCGC
ACTCATACATGCACCCAGTGCACTGCACTGCCTATGGGTCCTTATTTTCATTTGTGGAGATCGAAGTTACAGTACCCACTGTGTAAAGTTGGTCTCATTC
CTCAGCGAGAACCCTTTATCCGCGCTAGAAAACATGTCAGTACTTCTACCATAAAACTACAAAGTcgcccgaagaagctctgaaatttcaATGACACATA
GAGCAGATCTTGCGACTGCGAAACTGGTGCAGGAGATGCCTTTCTTAGAGTCTTTTTCACTTTAGTGCTATGGCGATGCCGGTCGTGCCAATGAGCGCGT
GAGCGAAAGGGAAATTCACATCTCCTGTGCCAGcttcgcagccgcaggaTCTGCTTTAGTGCTATCATAGCACTACTCCGCGACCTAATCCGTCTCTCCT
CCCGGCAATGAATACCTGTCCAAAACGATAAATTACTTTCAACGAACAAAACAGTATTATTTTGTGGACAGTAATTTGTCCAGTTGTTATTTGTAGTGAA
CCTCTATATAAATATGTACCATGGCATTTCTCTTTACATAAAATAAATTACCAGGTGTCCTTTGTTTGGAAACTCCACTCGGATCCTGTCCTCGTTCTGG
AAATAATTTTCAGAGAATTGATCTCACTAAACTTGTGCGAAAGTCTATTATTGATCAGCAA