Description :
From Genome Similarity Track
Location :
Scaffold_66:59438- 61520
Transcript NameFunction/comments
Phyci_82177myb-like DNA-binding protein, putative

Sequence
2082 bases(100 bases per row)
CGACCCCAGCCGCCGCCGCAGCCTCCGCCCCCGGCCCGACCAGGCATCCGGCGGCGCGCGCCTCCAAGAAGCGCAAGGCCAGCAGCGACGCGCCCGCAGC
CTTccgcgcctcggccgccgcgcgcgaggccggcggcgccgcggcgcgcTGCTCGCTCTGCGGCTTCGGCGCGTCCACGCTGGACCACCTGCTGACTCAC
GTGCGGGAGGCCCACGACCGCGCGCGCGACCAGGCGGCGCCCCAGATGGGTACGTTTGGTGTCCGCCAGCCGGTCGGCCGGCCAGTCACATCCACGTGAG
CCTGCGGCTCTGGGCTAACGCTGGCTGTGTGTGTGTGTGTCTTCCTCTCTTTCTCTCTGTTGTTATGAGCAGCGCTGCCGCTCGAGGTGGCGCACATGGT
GGTGCAGCACGCGCTGGACCAGGCGGCACTAGGAGGCGCCACCAGCGCGTGGCTCGCGGCCATGCAGCACCAGTACCGCGCAGCGGCCGAGCTCACGGCG
GCGCTCGAGCGCCGAGACGCGCACGGCGTCGCCGTGGCCGTCCGCAAGCTGCACAGCATGACGCAGGCCGGCGACGAGAGGACGCTGCTGACCACGCTGC
AGGAGGCCGCGCAGATCTTGTTGCAGGCGCCGCCCGTGTCCGCCGCAGCAGATGCCGCGCCCGTTCCTGTCGTGACGATCAAGAAGGAGATCCCGACGAC
AACAGCACAGAATGTGGCGCCGCGGCAGCAGCAAGGAAAGGACTCCAGCATCCACGAGGCGGAGGCGGCGCAGGCGCTCACGGGCCTGCGGGCCACTACC
TCGGGCGCGGCTACTACGACGGCGATCACGGTGCCAGTGATCACGACGTCGTCCGCGCGACCGCCAGCGGTGCCCAAGGCGTCGCCGACGGCTCCGCACG
CGTCGTTCCCCTCGTTTGCAGTCGGATCGCCGCTCACCATCACAGCGCCGCCGCCGCAGCTCGGCAGCCCACACTTCCACCCGCCGGAACTCTTCACGCC
CGGCACGGCGAGGTCGCCCAGCACCCCATCCTCACTACCAAGCCTCTTCGCGCGGAGGCTGTTGGCACCGCTGGCGTCCCCTTCCAGCGTGACGGACACG
GGAGATCGCCTAGCTCAAGGGGTGGCCGGGATGGGATACCAGAATCCAATGATCGTCACGGACCAACGCAACACAATCGGCTCAACTATTCGTCCCGACA
CGTCGCCAGGAACGCACACCCCAGTATTCTGCTCGTCCTTCCCGGCGCTGTCTTCGAGCACTAGTGGCGTCAACTCTGGCACGAATCGACCGACGTCGGC
ATCCCCCCTCAAGCGCAAAAGTATCACGTCAAAACAGCTCAGTGTGAGGTGCGACGCGGAGGTTGCGGCTGCTCGTGCTGCGGCATCCACAGCAGCAGCG
GCTGCAGACGCCACTGGTGGACTGGGGCCGCTTGGACCAATCTCGATTGCTCCGGGCACGCCGAGCACCCCAGCAACGCGCAAAGCTACGCCTCGACGAT
GGACCAAAGAAGAAGACGACGCTCTGCGTTCCGCTGTCGAGAGCCACCGCGAGAAGAACTGGAAGGCCATCGCCGCTCAAGTGCCAGGTCGCAACCACAC
GCAGTGTCTGCAGCGGTGGACGAAGGTGCTGGCCCCAGGACTCGTCAAGGGCCACTGGTCTCCGCACGAGGACGACCTGCTGCGCCGCCTCGTGGCCACG
GAGCAGAAGAACTGGGGCGACGTGGCGTCCAAGATCCCGGGCCGCACGTCGAAGCAGTGCCGGGAGCGCTGGCACAACCACTTGGACCCGCAGATCGTGC
GCGGCGCGTACACGCCCGAGGAGGACCGACTGATCCTGGAGGCGCAGGCGCGGCTGGGCAACCGCTGGTCGGTCATCGCTGCCATGCTTCCCGGGCGGAC
GGAAGACGCCGTCAAGATCCGCTGGAAGTCGCACTGCCGCGTGTGGCGAGCACGCAAGTACCTGCGCAAGAACCCCAACAGCGACGTGGACATGCTGAGC
GAGCCCGCGCAAACGCCGCGGACGCCGCTGGTGCCTCCCACGGGCGACTTCACGTGGCCTGTGCCGCCCCCAGCCGCGTCGG