Description :
From Genome Similarity Track
Location :
Scaffold_419:59433- 60718
Transcript NameFunction/comments
Aphin_H310_00849beta-glucosidase

Sequence
1285 bases(100 bases per row)
GGATCGGCCACAATTCAAGCCGTGTCTCAAAAACCTCGATACACTTACGCAATTTCGGGCCTCTTGGCAGCCAACTCTTACTACGTGCGTGTCATGTCGT
ACAGCGCTGGGGGCTTCAGTGACCCGACGACGGCAGTTCCATACTACGCCAACAATCGCGTCACGCGGGTGGTCGTGAGCCACGCCAATATCAACGGCAT
CCTCGCGGCAGCGATCCAAACGTTCACGTTTACGTTTGCCAATTATGCCACGGCAACTTCTGCTGTACCGATCAACGCCCGTGCCGACCAGATCCAAGCG
GCGCTGCAGTCGCTTGTGCACGTTGGCGCGGTGTTTGTGACCCGGCGCGATCACTCCACTGGGCCGTTGCTCGCGACTGTCGATGCCACGGGTGTCGACA
CGGACGGTTTCCGCATCGAGTGGTTCATAACATTTGCCACATCGTCCGTGGACAATATCGCGCCAAGTTCTCTCGGCGCCTTGTCTGTCATGGTGTCAGC
GGGAGTCGTTGCTGCTACAGACTTCAACATTGCCGACGTTGTGGCTGGGAGCGACCCGTTGCCGCTCTCAATGACCCCACGCGCCGCGGCACCTGATGTT
CCACTCAGTGTCACAGTGACGGTGGTGTCCAGTACGACCTTGGGCGTGCAGTGGCGGCCTCCGCAATACGTCACTGGCATCACGAAGTATTTGATCGAAT
GGGATTTGGACTATCAGATCATGTCTCCCGTTCAAGTCGGCACCACTTTCACCAATGCTCATGCGTTTAGTGCGGTTGTGGACGGGTCGACCACGAGCTT
TTTGATCCCTGGTCTCACAACAGGTGCCACGTACTACGTTCGCGTGTCTGCTTACAACGGACAAATTGCCCCGTCCGCCAAGGGCTACAGCTCAGCAGTC
GTCGCGACCGGTAGCCCAATCGTTCCAACGGCGCAAAGTCCATACAAACCCACGAATGTTGCTGTGACTGTGAGTCCGCTCAACATTGCGACGCAGTTGG
ATTTGTCGTGGAAGGAGCCAACACTGAATGCCTTGGGTTTTGCGCAAGGTGACGGCGGCGCATCGATCAAGGCGTACATCGTGGATGTCAGTACGCAGTC
AGAATTCGCAACATTTCAGTCGTATCCTGTTAGTACGTACGATGGTGCTGGAGCTGTGACATCCTGCGCAACGACCGCGTGCCACTTTCCCATTGGCATT
GAAGTCCAAACGTTAGTCGTTGCCGCGACGGCTGGGACATTCCAGTTGGTCCATACGTCGACTTACCCCTTGTCCCTTTGCGCTG