Description :
From Genome Similarity Track
Location :
Scaffold_578:5943- 8129
Transcript NameFunction/comments
Phyci_260267Hypothetical protein

Sequence
2186 bases(100 bases per row)
ATTTTTAGCCCGACCCCTCAATTCCAGTCGGGGGAGGAAGCCGAAGCCATGGGGGCGTACGAGGCGCTGGCGCTGGCGCAGAGCGCGCAGGCGTACCTGC
TCGTGGGGCTGCTGGGCGCGGCCGTGTACCTGCTGCTGGTGCTGTCCTTCCTGCTGGTGCCCAACATCCGCGCGCAGCACCCGGCCGCCAACCTCGTCGC
GTGGCACGCGGGCTGCGGCCTCGTCTCGAGCGCCGGCTTGGTCTTCGCCTTCGCGCTGCAGCGGCGCGCGGACGCCTCGGACGTGGCGCTGGTGGCGCGG
CAGTGCGCGCTGTTGGCGCCCTTCAACCAGTTCTTCCTGCTGGCGGGCGCGCTCTGGTTCCTCATGCTGGCGCTCGACCTGCTCGTGGCGCTCGTGAACC
CCTGGATGGGCTACCGCTGCAAGGCCTGGGCCTACCACACCATCGTCTGGAGCGCCAGCGCCGTGTCGGCGCTGCTGCTGCACCAGCTGCAGCTCGCGGG
CCTCTCGCCGCTCAACGTGTGCTGGGTGCGGCGCACGCGCGACCCGGCGCGGGTCAACTCGGCCAACTGGGTCTTCCTCTTCGGCCCCGTAGGCGGCACC
TGCCTGCTGTCGCTGGCCGTGCTGCTCTTCGCGAGCTTCCGCTTCGTGCGGCGCCAACTGGACGTCACGTACCGCGCCAAGCGCCGTAACCTCGTGCAGT
ACTACCGCTATCTGCTCATCTTCGCGGGCCACTGGGCGGCCTGCGCGACGCTCTACTACGCGGCCTACCGCCAGCGGTTCGACGGCAAGATGGCTAAGCA
CTTCGAGCTCGCGATCGCACTCGTGTTCGGGTCGTACCCCGTGCTGCTGCTCATCGTCTGGGTGCTCAACACGGAGCTGTACCAGAACTTCTCCAGTGAG
AACAACTTGTCCAAGGCCGAGCGAGGCGCGGGCGACTCGGCGAGCACGGAGCACTTTAGCGCGGCGCTGAGGAAAGACTTGATGCGGTACACGACTGCAG
GCATTCGCTGCAGCCTCACCGAGTCCCCTGCCGACAGTCTGCGCTCGCCGCTGCTCAGTTTGGCACGCGATCGTTTTGGTTCCCTGGATCGCACTGCCGC
GCTGTCGTTTCTGCAGATGGAGGAGGGCGGGTCGGCCGGCCTGTACCACGAGAAGAAGCGACTGGCGACGACGGTGTACAACGGCGAGTATCGGTACTAC
GAGAAGCTGGGCTTTACCGACTACGCGCCCAAAGTGTTTCAAAACATCCGCGAGATTTGTGGGATCGACAACGAAATGTACGAGCAGTCTTTTGCTGACA
CACTTCTGGAGCGCGCGTCGGAGGGCAAGTCAGGAATGCTGTTCTACTTCACTAGTGACCGCAAATATCTGGTGAAAACCATGACGAAGAAGGAACACTC
GTTCCTGCTTGAGGTGCTCCCGCTGTTCCACCAGTACATTTTGAAGCAGCCAAACTCGCTTCTGTGCCGCTTTTTAGGCTGTCACTCTATGCAGCTCCCT
GTTGGATGGAACAAAATGTTTTTTGTGGTAATGGAGAACATTTTCCCAGATGGGCCAGTCGATGAACGCTACGACCTGAAGGGTATTTTCCACCAGTCCA
ACATCAGACACCGAGAGGGAATCCCGACACCGGTGTCAAGCGAATGGAGCCGAAGTGCGAGGGAAGAAGAAGAGGTAGTACGCATTCTCGATGAAGATGA
AGCGGCGTCTAGCGAGAGCCAAAGCGTGGACAGTGAAATGGGACACATAACAGAGAAGCAACCACTTCTACGTCGTGGAAGCTCACGCCCTTCGCTTCGT
TATGAAAATGACTTCGTAACTCGCCGAGCTTCGCTTCACGTGAACCCCACGACTCGGGCAAACTTGCTCGCCCAAGTGACGAGCGACTGCGGGTTCCTAC
AGGAGCTGGGAATCATGGATTACAGTTGCCTACTTGGCATCCGACATTACAACCAGCGCATTGAGCCCGAGGTTATGGATAACCTGGCGCACAATGCCGT
CGTGTCGGCTGACCAGTCTACTGTCTACTACCTCGGTTTTGTGGACATTTTGCAGCACTACAACATCGGGTGGAAAATGCAGCACTGCTTGCTAGCTGCA
GTAGTCGACAAGCGACAAATCACGGCGCTACCTCCAGCTGAGTACGCCCTGCGATTTTTAAACTTCATCCACGAACGTTTACTGCG