Description :
From Genome Similarity Track
Location :
Scaffold_6:594141- 595947
Sequence
1806 bases(100 bases per row)
CATACGCGTACTATGCGCTTCTCGGTTTTAACGATGGCACCCGTTGCCAATCGAACTTCCAACATACTTCGAGGTATAATTACCTCCACGAAGTCAAGCC
TTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCGAAGAGAGTTGCTCTCTCTCTTCGAAGACCCGTTCAAGATGACAATGTTC
GGTTTGTCTTTATGCATTTTGCAGTGAGAAGGGTCCTCACTGGGGGCTGCAGTCCTCAGTGTCGCATGTCCGAGTTGGACACGCGTGACTGCTTCACCAG
TAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTTTTTGTTTGTCCGCGACGATGCCCGGCATCGCCGCGTCGACCACCATCTGGGTGCACGGGTGCCGTG
CACTCTCGGGCATTGTGACCCATCCTTCCGCAACGGAAGCATCGTACATTACTTCCTCGTTGCTGTTGATAACCAACAGCTGTTGCATCCGAGAGGTCCA
TTGGTTCCGAACCTCCCGCTATCGCGACCGGAGGCGGTTCCAGCCTCAGCGCATTCGCATGCAGTTTAGCCTGCCTCAGACTAAACTCCTCCTGCATTGC
AAGAGTAATCGCAGCTTCGAGAGTACCTGGGTACTCACGGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGACCCTTCATGAACGTGACGATCTTGGTC
GCCTCGTCTATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCTCTCTGCGCGTAAGCATGGACATCATGCTTACCCTGCTGTAGGTCGAGAAACT
CTGCCCTCGACCGGAACTCGTTTTGCTGGGGCTCAAATTCTTGTCTGAGCTCCTCCATGAAACCCTCGTACGTGCTGAAGCACGTAGGATCAGAGAGTCG
GCGTCCATACGCCCAACTTCTCGCTCGTCGCCAAGACATGACATGGCGAATGTAACCTTGGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAATGT
CGAGTTCGACAAGCCACCGGATGAGAGATTCGCCCCCTCTTCCGACATAGTTGCTCACGTTTAGCTTCAACGATTGCTCGTGCGGTGTCGTCCCCGACGC
CACCGTGATAGAGGAAGCAGCATCACGCTGCTCCTTCATGATGAATCCCAGAGCAACACCGTGTTGCTCCGTCGGCGCTAGTGTGCGTAGCATTGCAGCT
ACAGCCGCTTCTCCAATGACTGTTGGCAGTCTTTGGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCG
AAGTGGAGCTTTCCATGGTCACCTCCGCGCTCATGAAAAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACG
GACTACTAAGTGCTACCAGGTGTAATGGGCCTACCTTGACTCACTACTACGGCTTACACGTATCCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTGCTT
GAGTTAAGTATACTCGAGATCCACGAGTATGCTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGTTATTTTTGTTTTAT
GTTTCTGACTTCCTCTAAATGTAATATTCTAAACTAGGAATCTGCCAACGGCTGGTTTGCAGGATTCTGCTGACATGTAAGTCACTCATTGGCTAAAAGT
TGCTGCTTTCAGCCGATAGGAATTCTAAATGTGTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTTACACCAAGGTCGAG
GAAATG