Description :
From Genome Similarity Track
Location :
Scaffold_11:59404- 65083
Transcript NameFunction/comments
Physo_341380Hypothetical protein

Sequence
5679 bases(100 bases per row)
CTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCGGGAGCCGACACTGCAGGCGGTGCGAACGGTTGCAAACGTCCCGCACCGGAAAAA
CTCGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTTGCCCGCGGACTGTATTTGCCGGCGGTACTA
CATAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGTTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCG
CAAGTCTCGGCCCGGGGCCGAGACGCTACAAGAAATGTCTGCCAGGCAGACGAAGGTTGAGAAGCCAGGCGTCGAGACGTTGACGCGTACCCGTGCCGGA
TTCCGGTCAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCA
CGATGGACGCATCGAGCAAATTTGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGACAGCACCACTGAG
AGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGACGAGCAGAGCTGGGACTCGTTTTCAACGTGTCCCTACTACGAGATCTTACGGGAGT
ACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCAC
GCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCAC
AGTGCTCCGACGTTCTGTATCAAGAAGCCATAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGTGCAGACACCGA
TACCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAG
CGATATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACACCCCTGCGACCTTCAACAGG
TGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTG
AGAAGCACAAGGTGCACCTCCGAAAGCTGCTTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAAAACGGTGTCCGCCCTGAC
CCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACACCGTCGAACGTCAAGGAACTGTGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTATGATA
CGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAACAGGGCTTGACGGAGGCGC
CGATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGG
TCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACCACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTC
GAGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATATGGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAAC
GGATGGCGAGATGGCTCTCCTTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACC
TGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCG
CACGACGTGGACGCGAAGCTCTTGCTTGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGTTGCCGAAGCATCTTCGTGCTCGTGCACACCGTT
ATCGGGTGCACGACGGGTTATTACTCTACAATGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTA
CGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTACAAATGGGTG
CGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGTCTGCGCCTTTCGCGCAGGCTCCCTTGCAGCCACTACCAACTCCACGGGAGTGTTGGC
AGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCT
TGCTGTGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGAT
CGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGC
AGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGCTCGCCAT
CAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATACCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGCGGCTCCTTCC
TTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAAGAAGAAGC
ACGCGTCTGTGCAGGGCACATACGCCGACAAGACCAAGAAGAAGAAGAAAAAGAAGAAAAAGAACGAGTCTGTGCAGGGTACAGACACCGCGAAGACGAA
CGCAGAGGCCGGGTCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAA
GACGCTATTGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGCAGGGGCAACACTAATGAATTCGAGAAGGGTTCATTAGTCTTGTTAG
CTACTCAAAACGTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAA
CGCCTACACGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGAAGGCTGAAGCCATACCTGCAGCACGAGCTACCTAGCTCGGCT
GGCCCGAAGCGGAAGCCCCAGCGGGAGCGAACCTCTGCTCCAACGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTC
CGACGCGGTCTGCGTGGCCTGAGCGACTTGAGCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCCACAGCAGCG
ACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCA
ACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAACCGAACCGGCAGCCGGTTCGTTATCGTATTCATTGGAGAGGGTTTCTGCCCCACC
AAGATACATGGAAGCCACGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAAGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGA
GCGCTGTGGTCACCTACAGCGCCCGAGGTCCCACGATGGTCGCGTTCCTCACGTGCGAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAG
TCGTCGTGTACCCGTTTAGGTCGCGGTCACTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGC
GTCCACAGAAGATCTGTGGAGCTGCTCCAGCCGCCCGCGCATCGAGAATGGCTCGAAGTGTTCACGGGCGTGCTTAACCCGCTCACGGTAAGCAGCCGGC
TTCTTGTTGAAGTTCTCAACAAAAGCGTTCCAACCTTGACAAAGTGCCTGCCACTCAGGCACTTTGTTGCGAGAAGAAGTCTTCTTGCTGGAGAAGTACC
GGAGCTCGTGGAAGAGCCCGATGTAATAATCGCGCCTTTGATTCGTTAGCGGATCAAAGTGCTGCTCCTCCGCAACAGCATCATCGTGGATCCCGCTGCA
TACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCTGCGATCTCTGGCGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGAAGCG
CGCGGAGAGCTTGAAGGCGCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTTGAAG
CGTCCGAATCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTCCGGAAAGGCAACTA
CAGGCCTTGGCTCAGCTCCACGTCGTCGTCTTCGTAGTCAACGGCGTCGTTGACTACAGCGGAACCTTCGAGGACAATCTCCGACTGGGTTGTCCCCGAC
GCGGCCTTTGCAGCGAGCGCATCGCGCTTTGCCTGCTGGAGCTCATGGTACTGAGCAACAGAGAGGTTCCCCTCTGTTGCGGCGGTGGTCTTCTTCTGCG
GCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCGACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTGCCGTGACTCGGCGCGTCT
AACCTTGACGGGGGGATGGTGTAACGGGGTTACACGCACAAGTGGCTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTCGAGGTTTGAACACTT
CCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGC
ACTTTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAAC
ATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTACAATTAACTCTA
ATTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATAACA