Description :
From Genome Similarity Track
Location :
contig_41:594- 5670
Transcript NameFunction/comments
g7183.t1hypothetical protein

Sequence
5076 bases(100 bases per row)
TACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGT
TCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAGAGTTCAAGGAGGAG
CTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAA
GAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGAC
CTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCC
CCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGAT
CAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGT
ATCGTCACGGGCAATAACTAAAACCAGCAGGGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCC
CCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAG
TGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTA
GCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGG
ACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAG
CAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGT
CACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGT
CCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTG
GGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCG
ATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGG
AGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACA
GGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGATAATCCTCCGACGTTAGCGT
CGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAG
GATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGG
GACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTC
AGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAG
TCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCG
TACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTC
TGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGT
GATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGAC
GTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCT
ACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAG
AGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGC
AAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTGAAGCAGTCAAGCAGGGCTTGACTGG
AGGCGCCGATTCTTGGCGGTGGCGCCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCAC
GAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATG
CACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATC
ACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGT
CGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGTGGACGACGTGAAGGCCGCATA
CGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACAC
CGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCA
CGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTG
GGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGC
TGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGC
ATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTC
GGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGAC
GGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCG
CCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCC
TTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCG
CGCAGTCATGGCGACGACAAACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCA
CGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGAT
CGACAGAAGCTGAATGCCGATAACACGGCAGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCA
GTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCA
GCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGA