Description :
From Genome Similarity Track
Location :
Scaffold_1963:594- 2209
Sequence
1615 bases(100 bases per row)
GCCTTTCCGGCAGCAGCCTTGGAGCGTGTTTTCGCACCGCTCTTCGCAAGGCATGCTAAATGTCGTTGTGCAGACCGCAAAGAAGAGCACGCGACCGCTG
CTCCAGGCTTTAGCTGTAAAGTGCCCTGCCGCGCTTGCGCAGCCAAGTCGATGTATTTTGACTTTGAGAATGAGAGTTTGTGGCGTACACCTCCTCATTC
TGATTGGTCAGTAAACCGAAGCTAAGTGTAGCGGGGTACGTAGCCTCAAGTGCACCCCAGGTTACGTGAAGTGTGACACGTCACACTTCGGGATAGGGTC
GTCCGTATCCAACCATTGGCTGATGACTGTGCTTTTCTATATAGGTGACTTATAGTTTGTGTATTTAACTCAAGCTTAGCCTACCTATAAATAGATTCAG
TTTACAACTTACCTTAAATTGGTCACTTCGCTCCCTTAGACAAAAGGGACCTGTGAACTACTGTTCACAGATAGTTTGTATACTCTCGGAAGCAAACTTC
CTCTAGCGCGAGGTGCTGTGTGACTCCGTCACAGCTTCGAACGGTACATGGTGTCAATGTTGACACATATGCCACGCTTGAGTACTGACACGTGTCGATA
AACGACACCTACGTGTCGTTGGTATGAGCATTCGTCAACGCGTCCTCGTGCTTGAGATTGCACTTGATCTAGGGACTGGCGGTGATGCTGCTACCCAGGC
CGGGAATCAGGGCGTGCTCGCTCGTCTTGCGGACCGCCTGGACAAGTACGAGCGGGAGGTCTCGAGCCTGCATCTGCGGGTGGACCGCCGGTCCTCTTCG
CTCGATCTTGACGAAACCTTCCGCATGATCCGTCGTGTTGAGGCTCTGCTGCCACATACTGTGCCGCTTTTGGCGCAGTCCCATTCGTACGCGTATGGTG
CGTACCCGACGTACTCGGCGTACGGCTCCGGAGTCCGTTCGTACGGGGCCCCTCCGGCGTACGGTCTTGACCGCAGCTTTGCAGCTCCGCCCGAGGCTTG
GATGCCTGCTCCGACGCCCTCATCGACACATGTGGCCGGCCCCCGCTACGAGAAGTTGGGCCAAGGTGAGTCTGCGAGTAGCAAACCCAACCCCCTGCGG
ATCATAGTACCGCTTAAGACGTCCACGTAGAGTGTCGGGTGCGTCGTCATTGATTTAGGCATACCGGTGGTGTACGACGCACCATGCCTGGCCAGGACTG
CGTCCGGTCCAATGAAGTGGTGCTTCAGTTTGTTGCGGCCGACAGAGCTGACAGTGGCTAGCGTTAGACCCCTCGTGTCTAATAGCACTAAGCCCCCACC
TTAAATGCACTTAAGTTATCTCTTCCATGTTTGTCAGAGTACTCCTTCTGTCTGTCTTGAGCTGCTGCCATGGCATCGCGGACCCTGCTGATCACGCTCA
GCTTGGTATCCACAAATTATTCCACTTGTTTCCGCAACGAAACCGGTCTCACGTCGGAGACCTGGGAGGAAAGATCTTTTCGAGCCTCTCCCCAACATAG
AATAGAGGATGCAGTGTCTCCTCGAAGCGAGAGAGGCACTCTGTGGTGGCGGAAGCCATTCAGGTAGAATGGCGTGAACCCCGTGGACGCGTCCATCGCG
TTGCTGAGCGCAAAC