Description :
From Genome Similarity Track
Location :
Scaffold_3:59375- 60622
Transcript NameFunction/comments
Hyaar_Emoy2800523Folate-Biopterin Transporter (FBT) Family

Sequence
1247 bases(100 bases per row)
CGTTCGCATTGGCCTGGTCGCTTGTAATTAACCTGTTGGGCATATTCGACAGCACGAGGTGTCTAAAAATCGTTGGGGGTTGTTGAGGAGGACAGTAGTT
TGCATACCGGTGGGTTGATAAAAATGCAGACAGATATGTGTACTTGAACCAATATCTTATTTGTATTATTTACTCACCGCTTTGCTGTAGATCTATCCGT
TGCTGTCATTTCACTGTCTCGGGCATACGTAAATATGATTTTACATGAGAAACTAGTTGCCATCCTATGGCTATTATCACGAGCAACTGAGGAATGAAGA
AGCATTGAAAAGACTCAACCAAATAATAGTTTAAGTCTGTAGCCAAGCTCTATTATCTGAGTGTTTTACTTTGTAAGTGTTTGCACGGATGTTTGCTCTT
AAGTAGCTTGTTTTCGTCAAATCAATTGTACTGCCGCCGAGTGTGCTATGTTTGCATGGAAATTCATGAATATCGACGTATACCCACATTTTTCAGCGTC
GAATCGATTAGCCGTTGTTAAAGGAGGGACAGTATTTAAGCAATTGTGAGTAAAACGTTCCGGTGGCTCAAAAGTTGTATCAGATTCCGTTCTGAGCATT
GGCTTGTCAGTTCAAATGGAAGTGTTACCCCATGCAAGCCATCAAATAACTGTATTCAGTACGTACTGACCCAGCAATGCCGCTAATTGTTAGAAATAAA
TGAGATTTGATGCCAGTAGACAATGCAACGTTTGCGACCCACACGACATGTTTTCATTCGATTATAACATCAGTATATACAAAACTTGTGCGACCGTAGA
AGAGTGCTGCAATGACAGCACTTTCTCTCTCCGAATATTTATGGATCCGGAGGACAAAAGAATTTAAAAACGCAAATACACATACTTATCAAAATGATGT
AATAACAAAGCAAATAAATAGTATTGATACAAGTATCCCATAGAAAACATAAGTAACATCACCGCGCACCCGATCAACGACACTTACAACAAGTCAGAAC
ACAATCCCTATGATACTGACGCAGTAATCTTGGAGCTGGTGGTCTGTCTTGTACAGATTTTCAGCTGCTGACAAGGTACGTCACCTCCAGGCTGCTGGAT
AGTGTATGCACAAGCCCCGGGTTGTGAGGCGAGTCTTCCTCTATATTCTATGGGGCTTGGAATTTCTCGAAAGCTGTACTTATGTAGTGATTTTACAGCT
TTTGTCTATGAAGTGATTTTACAGCTTTTGCCTATCTGTCAACAACT