Description :
From Genome Similarity Track
Location :
Scaffold_4:59373- 63109
Transcript NameFunction/comments
Physo_504047AlNc14C988G12696

Sequence
3736 bases(100 bases per row)
GATCAACATCGTCGCGCTACAGCTTCTCCGTCACGCAGTCGAACTTCTATATGTGCTTCGGCAGCCTGAGAAGCTTGCGGTGCGATGCTTGCTCCAGTCG
GTACCAGCTCTTTGATCGCTTCGGTAGTATAATACAAAGCATTTAGAGGTTGAACGCGTAATATACGGTAAGATATAATGGAGAAACACCACAAGCCCTA
AATTTCAAGCGCTACAAAGTTATCTAAACCAAGTTTAACTCGTCTACTAGAACAGCGAAAACCGGGTAAGTAGCAAGGTACATACGTTTATCAACATTCA
CAGAATTATAACCAAGATAGGCGGTACCTTTAGCAAAATCATTACCAAGGCAGCTAGATACCTTCACCAAATGAAACCCAAGATATCTGCTTTCAGCAAC
GTCGATTAGAATCCGAACCCCCCAGCTGTTTTTTTTAAATTTAATGGGTACACTCACTACCTACACTCCAAACTCTTACAGCTCACCACAGCTCGAGTTG
TTCATAGTGTCACTTCTAAAATAAAAACGACGCTCCGAACGTGCTTGCTCGACGATAACCAAGCTGGTCATTGCGTTTAGAAATCAATCGATTCTCGTGG
TTAAACGCGTCTTGCATGAGGCGAGCAAGTTCTTCAGTGACCTGTCCGTAGGGACGGTAAATGTTGAGGATTTCAAGCTCGTCTTTGTGGACATAGACGT
AACCGCTGACGTGTCCACTTGATCGGACGAAAGTCGCCACAAGCCGACTGCTTCTTACATGAAGAACAGATTAGGTAGGGAGCGGCCTTCCCTCTAGTCA
CGTCCACGAAACTGGCCGACGCAAAGATGCCCTGAGGAGGATGAATTCTATCATACAAACGTTACGATATTACGACAAAAAAGGCATGTATACTGAGCAT
ACATAGCTGCAAAACATTATGTATAGACCGTGTGTGTGTGGTGAATGGGGGTTAACGTAAAGGTCTGATTAAAGTAAAATGCAAAAAATCATATCCCAGT
TACCTGAAATCGGGAGATACCAGCCGCGTTTTGGTGTGTTACCTCGATATATTAATCGTGGTGCCATGAACCAAATACTACAACTTGATTTGTAGTATTA
CTGACCGATTTGGGGCGATACTTCTTTGCGCGCCACTAACTGATCTCAAGACGCCGTCACCCGTGGCTCGTGGCATCGAGTATTCTATCCAACTTGGCGC
TCGAGAACGGAAATCTGTCCGCCCTGCAAAGCACTTGTCTCTACGTAATACTGGTCATCAGGTACATTGTTATACATTTCGTGGGCAAGAAGCAGATCAT
TGTCACGTTCCACGTGCTGCAGATTATCGTGAACATCTTGGGAAGCCATTTCAAAGCCACTTCGCCGTCACGGCGTACAGATACACCTGCAACGTGACGC
TGAGTCTCATTCTCAAAATGAAGGTTCCTTTGTGACGATCTTCTGCATCATGTCTCTCAAGATGTGCACCGCGCAACACAACAACCTGGGCGTGATTGTC
GCGCTTTGCGACTCCGTCGCCAACTTCGTGCCCGGATACTCATCATTGACCAACGGTACCTCGAGCAACGTGGCGTGCGGCGAAATGCGCGCAAACATGG
CCGCCGCATCCTACGGTTCGCCCAACACCAGCATCCAGACCGTGGTCAAGACGCACGACGTGGACTCGAACGCCAAGTGACTGGTCTTGACGTTTGAATT
CATGAAGTGATATCTTCCGTGTTCCAGATGGCTGTACGCATGAATTACACTCAGATTGAAAACTCAGAAAGTCGTTGAGCGTATCCGGCACTGCCTGTGC
GCAAACCTGACAAAGAGAATGAGTGGAGGCAGACGATTTACTTTCGACCGGTGAATGCTCTCACACAACCACTTGCAGGTGGCATGACGAACAACAACAT
GCATCTGAACGGTGTAAGGGATAAGGAGCACAAACAAACTGCAGACTTCATCAAGAGCTTCTTCCAAATGGCTCTTGCAGCTGACCGTGAAGAGGGCCCG
TCGTACATGGCAGCTGATGGCGAAGTCGTTACGCCGACTCGCCTGTAGCAAGGCTCCGTGGGCTCTTCCCTGCACTTTTAGCAGTCGATCTAAAAATTGA
TGCGCGAGAAGAACCTTTTGTTTGAGCAGCTCATTTACGCAAGGACAATTGATGGATTTCCCGAGATTGTTGATATAATTTACGCGCAGTTGGAGAAGTA
TGGTCTGTTTCTACGCATGGACAAGATCTGTTTGTACAACAGAACCGCGAAGTGGTGTGGCCGCGTGCTGACCAAGGACGGTGTGGCGTATGATTCGAGT
AACATCCAAGCTCTCATTGACATGCCCGTGCTCGCCACCGCTGGAGCACTACAGCAATCCTGTGTGCTGCGGACTGGATACGTAGCAGTCTAGTCGACTT
TGCTCGGGTCTGACAGCCTCTACAGGCGCGGCTGGACAAGGAGCTGGCTGGCACTCGCCGCACCAAGCGAGTGGCTAGCAACATCTCCATTGAGTTGACT
CCAGATGAGATGTAGAGCTTCAATAACGTGAAGAAGCTACTTCAGAATGCTGCAACGCTTGCATCACCAGATCCAGCAGGCACTATCTGCAGGTACGGTG
ATGCGAGCGACGAAGGCTGGAGCATCCTTTTATCGCAAATGAGGGACCGGGACAATCGCGCACCAGTCAGCGACCAGCACCTAATCTCTTACACTGCATG
AGCGGGATTTTTCATGGCGCCTCTAAGAATTGGAGCGTCATCGACAAGGAGGGATACCCGATTGTGCACGCATGCTCCGAGCTGGACTACCTGCTCATCA
GAGACAAGGGATTCAACATGTTCACTGACCATCGGAACCTCATCTATATTTTCGCTCCTGGCACGGAAATCAAGAATCACATTCGTGACAAGCTTCTCTG
GTGGAGTTTGAACTTCAGTGAGTACAACTATTTAATTGAGCACATTGCTGATGAGGACAATGTCTGGGCTGACATGTTCTCCAGGTGGGCTGGTAAAAAA
TCGGCTACAGCTCGAACCTGCTCGAGGAATACTGCGACGTCGTCTCAGCTTCGCCCCCTGGTTGATTAGTAATGGCCAAGCATCGATGGCATTCGTGACG
CTCAACGGGGCAAAGTGGCGCCCACCTCTCATCACTTGGACGACCAAGATGTGTACGTTGACTCCAGTTCCAGGCCGTGGACTCAGAGGAAGCTGAGGAT
CCCCCTTTCCGCCTCATGATTGTGGCTCACTGTGGGACCCAAGGGCATCGTGGGGTGAATGCAATGGTGCAGCAACTGGGGCGATTCTTTGACATCACTA
GCGTGCACATCAATGCAAGAGCGTTTTGCGTAGACTGCCTACTGTGTTGCCATGCGAAGGGAGGCAACATCGTCCCCAGACAGTACGGCGAGTTTTTCTG
ATCTGAGGAGCGAAATGAAAATATGCACATGGATTTTCTTTACGTTGGGAGCTACGACGACACTAGCGACTACATTTTAGTGCTGAAGGACGACTACTCT
CGCTTCTGCGAACTAGTGGTATGCAAGCAAGCCGACGCAGCAACAGCAGCCCATGACATTCTGGAGTGGAACATGCGATTGGGCCACCACAAATACCGAT
CAGCGATACGACAGCCCACTTCAAGAACGAGTTGATGAGTTCATGCAGGGTCGTCAAGGATTTTCTGTTGCATACTGCCCATGTGATGATACTAGAATTT
CGACGACGACAACAGCAGTGAGTCGACCTTCTCCCA