Description :
From Genome Similarity Track
Location :
contig_38:59364- 63886
Transcript NameFunction/comments
g7056.t1hypothetical protein
g7057.t1hypothetical protein

Sequence
4522 bases(100 bases per row)
CCGCATCCACGTGCACGTCAGCTCATGGAGATGACTGTACGACAGCAAAAAATTGTTAACGCGATTCCCATAATGATGAAAACACCGCAAACAAGTAAAC
GACAAAAGCACTCACGCGCAGCAACAAGCAGCTCTCTTCTGCGTAGGAAGTGCACGCACCGCCCCCTTGGCGATCTCAAACGCCGTAGACACCGTATGTC
CATGAAATAGTGACAGGTAGAAATGCTTGGCAAACATCGTCGCCGACGCGTCGACCACCAGTGAATCCGAGTGCACCGCCACGACATGCGGGATGCCAGC
GTTCAAGAACACCGACGCGACCTTCTGGCTATGACACGCGTTGACAAACACCAGCTGCACATTGCATCCAGCGGTCTGGGCACAGCAGCAGACTTTCCCG
TGGTTTCCATCTCCACAGGCGCAGCCCCCGGCACCTGCTGCTGTCGATCTCCAGAGAACATCAACTGCCTCAACGCGTCCGGGGTGATGAGGTGCGTGCA
CCCCGCCCCATCTTCAAAGCAGAGCGCCGCACGCTGACCCAGTCCGTGGCCGGAAAAGTGCAGCACCGTGCACTTCCAGGCCGTCATGAGGCTGCGCAGA
ATGTCCGCCGTGGCGATGTCGAAGCGTACGTGGATGGCCTTGTGCTGTACATCTGTAAGCAGCGAGTTGCTGATCTCGCGCCGCTCTGCCTCCAGGTCCA
GCTTCTCCATGGGGTAGATGCGGTGGCGACTGTCCTTGATCACGAGCGGCGCCGCGTGCAGCACCACCAGGTCCAGCGCGTTCTCGTCGCGCGGCAACCA
GTTCGGACTCGGCTGTGACGAGGCAGTTGTTGTTGAAGTTAATGGAGCCGGTGCTGAAGATGACGTAATAGCCTCGCTTGAAGTCGCAATCAGCGCCTCG
AGCGCCTGGGAGAGCCGCACGCGGTCCCCGAACGCCGCGATGCCCAGGTCGTCACGCAGCGCGTTGCGTGTGAGCTCCGGCAGGATGGCGCCCGAGATCT
TGTTGGCGGCGAAGAGCTCCGCGTGCTCGCCGAAACCCTGCGCGCCCAGCCACTGGACCACGTCGGCGCACGACCAAGCGCTCCAGGGCGGAGCCGACAT
GCTGCCTCCATTTTGAAGTGAAAGTGAGGTAGTCACTAGATCAGCGGGATGAATCCATACTGAAATCAACAAGGCGTGTGTGGAAAAGACTGCGTTATTA
GTATCAGATCTGATTCCAATAGTTGCGGGTTCGGGCCATCCATTAGTGGAGCTGCTCATGGCGACTTCGGCAGGAGGCAAGAAGCGGCCGCGTGCCGACC
TGTTGTCGTCGCTGGACGCCGCGTTCGCGTCTACTGCGCAGCCTACAGCGTCTAAGTACACGACGCAAGCGGCTGCGCAGGCGGCCCAATGGCAACAAAC
AGCAGGCCTACCAGCACTCGAAACGGAAGCGCAAGGGCGGCAAGAACCACGACAAAGCTGGACACGCGCGAGGAAATGGCAGGGAAGCAGCGAAAGAACA
GGAGAATAAGAGCGAGTATAAGGTTGACCCGCTGTATGAGAAGATGGACGCGGAGCTGCTGGCGGTTGGGCTGAAGGACTGCTCGCTGGTGAGGACAGAG
CTGTTAGGTTTGGTAGTTTTAATGAGGTGCTGACGCGTGCTTCATTTGTGGTTATTGCAGCACCCACAAGCGAAAACCTTGACGAAGTCGCGGGCATTGC
ACGAGACATTCAAGAACTATCTGGAGTCGGTGGTGCAGGGAACAAGAGCAGGTTCTACTGCTGTGGTCAGTCTCAAGAACAAGGTGCTGTCCTTGGACAA
CCCTTTCAAGACGACAGCAGCGGAGACCTCGGAGAAAGCAATTACGGCGGCAAGCAAGAAGCAGACGGCCAAGCTGCTGAGTGCGAGACGGCGCAGGGAA
TTGGGCCTGCATCTGCTTAGCGGGAACATGAAGTACAGCGATGCGATGCTGCTCAACGATATCTGGACGAAGTTTGTTCGCCAGATTATTGAAAGCGAGG
TGGGCGTCGTTCAGGACGTAACGGTCGAGGCGCAGCGTACGCGAAACACGAAGCTCCAGGCTAAGCTCAAGTATCTGGATCTTTCCGGGTGTCCACTTGA
AGGTGCGTTCGGTAGACAGCTGAGTTCCTCGTCATACAACTGGGACTAACAATGCGATCGTTGTTCTTTGCAGTGATTCAATCGCAGAACCCGTGCAAGG
TTGGCCTCAACGGGATCGTCGTCGCGGAGACCCAACACACTGTTCAGATCTGCTGCCTTGCAGCTACCGGAGACGACAAGGACGACGGCCCTATTCGCAG
TACGTGCACCCACAAGAGTCGAGTCGCCCATGCTCCTCACCCAACCACTTCTTGTCGTTGCTAACACCCACTCTCGTTGGTGTCCACAGCTTTAGTCAAG
TTAGATTCGCGTTTCAAGGTCCGCCTCGACTCCACTCGAACCTGTTCCTCGATGGTGCGTGGTTCGCTGAGCGTGCACAATAGACAGCACTCTCATCCGC
TTGCTCAATGGCATCACATCCTTGCGCCGTTTGATACACCAAAACCAAATTGTCGTGTATCCATCTCACGAAATAAGAGCATAAATACTCTCTCTAACCG
CTGGCAGTTAACTTTCGTCGATTCGGAGGTCGTTGCTGGCATGGGCAACATCGCTCGCCTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGCATCCTC
AGCATATTTGACATTCACTTCCAATCGCCCGTGGAGTCCTCGATCCCCAGTAACGAGTACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCACGC
TCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGCACGCAGACCGCTACGATCTCAATGCGGAGAGCGCCTCGACGACCACCAAGTTCGC
TTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGCGGCAGTTGGGGCGTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCCAC
GTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCAAGAACTGGAAGCAGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAGTA
GTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATGCTGGCTAGACACGCCCCGCAAGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGATAT
ATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAGATGAAGGATTTATTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACAAGA
AGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCACCGACTTGCGGGACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAATATT
GCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGATGCGTACTTTGGAAACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATGGAA
TGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACGCGGACGGCGATCATTGCGTGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAATAGG
ACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTAAAGCTGAGGTGCAGGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCAGCAC
AAGAATGGAGAACGCTAATAATTTCAAGCGCAAGGATGTGATGCAGATAGACGTTGCACCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCGAAAC
TCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAGTATCGTGTGAATGCCATGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTGCGCA
AGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTCCCTACGCACCACTTCACAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAGCCCT
CAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCACAACGAGGCACACCATGTCATCGAAAATTGATCCAGGAGATGATCGATATCTGCCGGA
ATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTGCTAGGATCAGTCATTCTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCTATTT
ACAGCCCCAAAAATTCCGAGTGTCGTGGCTGTTGGTCCACATGATTGATGTAAAGTTTGTTGCTGCTGTGTAGTAGTGATGTGGTGGCGCTTTTTCGCCA
ACTCGCCATCGACATACTATCTGTATGGACTGTGTCCTCTTATCTTATGGAATTTCGTTTGGAACTATCGCGATAAACTCAAAGCTGCACTCCCTCTTGC
TCAAGATTTTGGGTGGCAGCAGAGTGTTGAGATTGCAGCAATATTTTTGTGTCTGGAGCAAGTTGTCCTTGGTTATCAACACCGAGCCATATTCAGCTTA
TTGTTCCTTCTGCTTGCGTTGA