Description :
From Genome Similarity Track
Location :
Scaffold_614:5936- 8383
Transcript NameFunction/comments
g14276.t1hypothetical protein

Sequence
2447 bases(100 bases per row)
TTTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGAGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGCCGCGCGTTATTTACAAAAAAGG
GGGTCAGACCCGTCGATGCGTGTTCCGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGAACGAAGTCGCGTAACTTCGAAG
GACATCTTCGAGGACTCGGTTGACCCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTTCGTTCCCAGAAGTTGGAAGAGA
CTCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACCGCGTCAACGAAATGCACCGCGG
ACTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGCCAGTCCGACCGTCGGCATCGGG
TGGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTGCGACGACTTTGACGGCTTCACG
CGCTGGCAAATCTCACAAGTACGGACCCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGC
CCAAGTGACCACCGACAGGGCTGTCGTGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATC
GATGCTGTACGTCAGCAGATCGCCGTCGAGTTGATATCGGTTAATCTGATTGCGCGTGTTATTCGGCAGCGCGCGGAGTGTTTTATCACTGGGGGAAAGA
AGATGTGCGAGGATGGCGGCATATACCGCGTCGTCGTTGTACGCAACGGCGATTTCTTCGCGTAGCGACATTTCTGGGGTCACGTTCATCAGGTTGACAC
CTGATGTCAAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTGGATCATAGTCTGGACGCCGAGA
CAGAGCATCGGCGAGGATATTGTTCTTGCCGGGCTTGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAACCATCGTGCCATGCGTTGAGACAGA
TGTGGGGACTTCATCGCTGTGCGCAGCGATGCGTGATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGATACACTCTGAATTTGATCAGAGCGTATC
GCATCGCAAGAAGTTCCTTATCGTGGACGGGATAGTTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGACTCGTTCGCAGCCTTCGTTGTC
AAACTGCATGAGCGCGCACCCGATAGCAAAGTCGCTAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAGCATCAGTATTGGCGCCGAGGCC
AAGCTCTTCTTCACCGAGTCGAAGGCTACTTGATGCTCGGGGCGCCACGACCACGTGGCGTCTTTCTTCAACAGCGACGACAGTGGCTGTATCAAGCCGG
CATATCCCTTCGTATACTTGTGCAAGTAGTTAGCGAGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTGGCCACGAGCAAATAGACGACAC
TTTTTCCGGGTCAGCACGGACTCCGTTTTTGCTTACGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACACTTCTTGAGATTCGCGTAGAGC
TTGTTCTCTCTCATCACTTGAAAGACCTGCCTCAAGTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCGTGACTGTGCACAAAAATGTCAT
CGAAGTAACTCGGAGCGAAGTCACGAAGCGGGCGTAGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCTTCAGACCTTGGGGCATCACGAG
CCACTCCCAGAGCATACCGCTGGGCGTACTGACTGCCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAAGCCATCGGTCAAGTCGATGGCA
CTGTAAATGACGCTGCCCGACATGGAGTCCAGTACCATGTCCTTCCGCGGGATCGGTGTCTGCGCCGGGATGGTGGCATCGTTCAACTTGTTAAAGGCGT
GTACGATGCGCCCCCCGCCAGTAGCCTTCTTCACACAGAAGGTCGGGCTCGAGTGAGGCGAGATGCTCTCACGGACGTGACCGGCTTGGCGGCGGCCTTC
GAAGAAGTCGTCGATGGCCTTGACTTGATCGCGCGGCAGTGACCACTGCCGCGTCACGCAGTACTTCGATCCAGGCACGAGGTCAATCTCGTGGCGCACT
CCGCGATCCGCTGGCAGCTCCGCAGGGATCTTGTCTGGGAAGACGTC