Description :
From Genome Similarity Track
Location :
Scaffold_218:59343- 64957
Sequence
5614 bases(100 bases per row)
CATGGACATCGTATCGGGTCCATGACTTGATTGCGCAGCTGCTGCAGCGGGGGCGGCCGAATTTGCCTCATTATCGGCACTAGCCCCATTCGGTTGTGCT
TGCGTGCGTGTTCTGGAACGTGTTGTCGGGCGTGTGGCTTCATTGTCACTCGGAGAGCTCATTCTGCTCTGTTGACGAGGTCTAGGGTTCGGGGACGGGC
GCTCAGTTGCACGACCTCTTCTTTGGGTCATATCAACCGGACTTCTCAGCGCCGTCACTATATATACTACCGAAACCCTAAACTAAAGCCTTTGAAAATA
AAACGGAACTGTCTAAATTCTTATTTACAGTCTACGTTTCTTGTAAAGTTGGACGGAGTGGTCGAATGTTCCTTCCAAAACCGTTTGGGTACGCTCGATA
AGCTGTTTCAGCTGTTCCGAAAATTCGTGAACGACGTTCCTCGCACTTGAATTTTTACAATCCGGAATTTCGTTTCGGATGAGTTTGACAACCTTAAGTT
GCTTTACCGTCGTTAACCACAGGTCCTTTCGAAGCTTATCAAGCTCCTTATGGCGATCGGTTAAGACCTTAGTGGTGTTGACGAACGGTTCTTCGGGCTC
GCGAGTTTTTCGTTTACCCATGCAACAATGCACACTGAAACAGTTGCAGTAGCAATGGATGTAGATCAAGTAAGACCAAGTAGGTATACCGAAAGGAAGT
TATTCTCCGTGTTTTCTGAGGCGGGACAGGGATTCACAAAGTGAAAGCACTAAACCGCGGACCCACAGAAGGAGTACCAATCGAGTAACCACACTGGTTC
ACAACCACACCGACTAGCCACTGAACGTAACGTTCGTGCTAAAAGACAACCCTTTCGCAACCTAGTGCTCCCCACGATGTGGCTCGCACTAATAGTCACA
GGATACTCGCTTCCCACTATGTGGCCACAAGTACCCTAGCCTTGAACTCTTGAACTTGAACCGAAGCTTGAATCGAAGCTTGACACGGCAAGTGCTACTA
TGTAACAGTCTTGCGCCGAGGAAGGTCTTGCTTGGCGTGTCCGGCGTGCGGTCCCTTGGGTAGGCAGGTGACGAGGTTGGTGGAGGGGTTGTTTGCTATT
GAAAGCAAATTGAGAAGTGATTGAGATTGAGCTGTTTGCTTTTACGGATGTCCTTGAGACCACTAGTGTCCTACCCTAAAGCCTATCCTTCTCTAATCTC
AGCTGCTATCTGTTCTACCAATGATCTTGTCTAAAATATCCACGTAGTTGTAGTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGAT
GATTTAGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTCTTATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGA
AAATTTATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCTGACGGCAACTGCGTCACACGTAACCACAGCTCATGCCGCCGCGTCCGGCC
CCATTCTCGGTCGTGCCGCCGTCTATAGAGTAACTACACCTCATGCCGCCGCCAACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCCATTCTCGG
TCGTGCCGCCGCCAACAGCGTAACTACACCTCGTGCCGCCGCGTCCGGCCCAATTCTCAGTCGTGCCGCCGCCAACAGCGTAACTACAGCTCATGCCGCC
GCGTCCGACCCAATTCTCGGTCGTGCCGCCGTCTATAGAGTAACTACACCTCGCTGCGCCGCCAACCAGCTCGTAACCCAGCTCATGCCGCCGCGTTCCG
GCCCCATTCTCGGTCGTGCGCCGCCAACAAGCCTCCTCGAACCTACACCTCGTGCCGCCGGCTCGTCCCGGCCCCAATTTCTCAAGTCCCTGCCGCCGCC
CAACAGCCGTAGACCTACAGCCACATTGCCGCCGCGTCCGCGACCAATTCTCAGTCGGCCGTCTCCGTCCTTATTAAGCATTAACTACACCTCGTGTCGC
CCCAACACAGCGTACACAGGCTCATGCCGCCGTCCGACCCAATCTCGGCTCACTTGCCGCCGTCCTATAGAGTAAACTACACCCTCATGCCGCCGGCCAA
CAGTCGTAAACCACAGCCTTCATGCTCGCTCGCGTCCGGGCCCAATTTCTCAGTCGGCTGCCGCCGCCAACAGCGTAACTACACCCTCGCTGCCGCGCGT
CGACCCACTCTCCGGTCGGTTGCCGCCGTCTATTTAGAGCTAACTACACCTCGTGCCACCGCCAACAGCGTAGCTACACCTCGTGCCGCCGCCAACAGCG
TAACTACACCTCGTGCCACCGCCAACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCAATTCTCAGTCGTGCCGCCGTCTATAGCGTAACTACACC
TCGTGCCGCCGCCTGCGTCCGACCCCATTCTCGGCTTCGTGCCGCATTCCGTCTTATAAGTAAACTTACACTCATGCCACTGCCAAAACAGATCGTAACC
CACAGCACCATGCCCCGCCGCGTCCGGCCCAATCTCCCAGTCGTGCCGCACGTCCTATACGAAAGTAACTTAGCAGCCTCTGCGCTCGTCTTATAGAGTG
TAACTACACCTCGTGCCCGGCCACCAACAGCGTAAGCTACCACCTCGTGGCCACGCCAAACAGCGTAGCCTACCACCTCGTGGCCGCCGCCAACAGCTCG
TAACTACACCTTCGCTGCCACCGCCAACAGCGTAACCACATTGCTCGTGCCACCGCCAACAGCCGTAACCACAGCTCATGTCGCGCCGCCGTCCGGGCCC
AATCTCTTCAGTCGCTGCCGCCGTCTATTAGCGTAACTCACCTCGTGCCGCCGTCTATAGACGTAAACTACACCTCGTGCCGCGGCCAACTCTGCGTACT
ACACCCTCCATGCCGCCGCCAACAGCGTAACTACACCTCGTGCCGCCGCGTCCGACCCCATTCTCGGTCGTGCCGCCGTCTATAGAGTAACTACACCTCA
TGCCACTGCCAACAGCGTAACCACAGCACATGCCGCCGCGTCCGGCCCAATTCTCAGTCGTGGCCGCCGTCTATAGGAGAACTACACCTCGTGCCAAACC
GCCAACATGCCGTAACACAGCTCAGCGCCGCGTCCGGTCATTTCAGTCCGTGCCCCGTCTATAGAGTAACTACACCTCTTGCCGCCGTCTATAGAGTACA
CTACACCTCGCTGCCCGCCGCCAAACAGCCGTAACCACAAGGCTCATGCCGTCCGCGTCCGGCCCAATTAACGCGTAAACGCTGCCGCCCGTCCATAGAA
AGTAACTACACCTCATGCCGCCTTGCCAACAGCGAACCCACAGCTCATCGCCGCCCGGCCGTCCCGCCCCAATTCGCGGTCGCTGCCGCCGTTCTATAGC
CGTAACTACACTCTCGTGCCGCCGCCAAACAGCGTAGTTCTACACCTCGTGCTCGCCTGGCCCCAAACAGCGTAACCACAGCTCATGCCGCCGCGTCGGC
CCAATCTCGTTCGTGCCGCTTTCCGTCTTAATAGAGTAACTACACTCGTGCCACCGCAAACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCCATT
CTCGGTCGTGCCGCCGCCAACAGCGTAACTACACCTCGTGCCGCCGCGTCCGGCCCAATTCTCAGTCGTGCCGCCGCCAACAGCGTAACCACAGCACATG
CCGCCGCGTCCGGCCCAATTCTCAGTCGTGCCGCCGTCTATAGAGTAACTACACCTCGTGCCGCCGCCAACAGCGTAGCTACACCTCGTGCCGCCGCCAA
CAGCGTAACTACACCTCGTGCCACCGCCAACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCAATTCTCAGTCGTGCCGCCGTCTATAGAGTAACT
ACACCTCGTGCCGCCGTCTATAGAGTAACTACACCTCGTGCCGCCGCCAACAGCGTACCTACACCTCATGCCGCCGCACTTCCGGCCCCAACTTCTCTTT
AGTCGCTGCCGCCGTCTATAGCGTAACTACACCTCGTGTTCGCCGTCTATAGAGTAACTACACTCGTGCCGCCGCCAAACAGTCGCTACCTACACCTCAT
TGCGCCGCCAACAGAACGTAACCACAGACTCTATGCCGCCCGCGCTCCGGTCCCAATTCTCAGCTCGTGCCGCTTTCGTCTCATAGAGTAAGTAAAACTT
ACACCTCGTGCCGCCGTCTATAGAGTAACTACACCTCGTGCCGCCGTCTATAGAGTAACTACACCTCGTGCCGCCGCCAACAGCGTAACCACAGCTCATG
CCGCCGCGTCCGGCCCAATTCGCGGTCGTGCCGCCGTCCATAGAGTAACTACACCTCATGCCGCCGCCAACAGCGTAACCACAGCTCATGCCGCCGCGTC
CGGCCCAATTCGCGGTCGTGCCGCCGTCTATAGCGTAACTACACCTCGTGCCGCCGCCAACAGCGTAGCTACACCTCGTGCCCGCCCAACAGCGTAAGCC
ACAGGCTCCATTTGCCGCCGCGTCCGGCCCAAATTCTCTGTCGCTGGCCGCCGTCTATAGAGTAACTACAACCTCGTGCCACCGCCAACAGCTCGTAACC
ACAGCTTTCACGCCGCCGCCGTCCCGGCCCAATTCTCGGTCGGGCCGCATGCGTCTTATAGTCAGTAACTGACACCTCGCTGGCCACCGCCAACAGCGTT
TAACACACAGCTCATGCCCGCCGCGGCCGCCGCCAATTCTCCAGTTCGCTGCCGCCGCCAACAGCGACTTCATGCCGCCGCGTCCGGCCCAATTCTCAGT
CGTGCCGCCGTCTATAGAGTAACTACACCTCGTGCCGCCGCCAACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCAATTCTCGGTCGTGCCGCTG
TCTATAGAGTAACTACACCTCGTGCCGCCGCCAACAGCGTAACCACAGCACATGCCGCCGCGTCCGGCCCAATTCTCAGTCGTGCCGCCGTCTATAGAGT
AACTACACCTCATGCCGCCGCCAACAGCGTAGCTACACCTCGTGCCGCCGCCAACAGCGTAACCACAGCACATGCCGCCGCGTCCGGCCCAATTCTCAGT
CGTGCCGCCGTCTATAGAGTAACTACACCTCATGCCGCCGCCAACAGCGTAGCTACACCTCATGCCGCCGCCAACAGCGTAGCTACACCTCGTGCCGCCG
CCAACAGCGTAACCACAGCACATGCCGCCGCGTCCGGCCCAATTCTCGGTCGTGCCGCTGTCTATAGAGTAACTACACCTCGTGCCGCCGTTTATAGCGT
AACTACACCTCATGCCGCCGCCAACAGCGTAACCACAGCTCATGCCGCCGCCACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCAATTCTCAGTC
GTGCCGCCGTCTATAGAGTAACTACACCTCGTGCCGCCGCCAACAGCGTAACCACAGCTCATGCCGCCGCGTCCGGCCCAATTCTCGTTCTGCGCTGTCT
TCTAGAGTAATACACTCGTGCGCCGCAACACGTAACCACAGACATGCCGCCGCGTCCCGACCCATATTCTCAGTCGTGCGCGTCTATAGAGTAACTACAC
CTCGTGCCGCCGCC