Description :
From Genome Similarity Track
Location :
Scaffold_836:5934- 9164
Transcript NameFunction/comments
Phyta_totarag10948multidrug resistance protein ABC superfamily

Sequence
3230 bases(100 bases per row)
GGCTTCATCATTAGTTTCACACGCGGATGGGATATCACGCTGGTCATGGCTTGCGTCGTCCCTTTCACTACTCTGTCGATGAGTTGAATGCTCAAGACGC
TTCGCGTCAAGTCCGAGTGGGCACAACAAGTGTACGCGGAAGCTGGTTCTGTGGCTGAAGAGACTCTGAGCTCGATCCGCACTGTTGCGTCGCTCACTGG
AGAAAAGAGAGCTATCGTCAAGTTTGAGGACAAAGTCAACACAGCGGAAAGGGAGAATATCTCGCTCCACAAGATGTCTTCCATCGTGTTCTCCATTTTC
CAAGGCAGCGTTTGGGTCATGCAAGCTATTGGGCTCTGGTACGGTGGTTGGAAGGCATCACAAGGCGATACGACGCCTGGCGACGTATTTGCCGCCTTCT
TCGGTGTTTTGATGGGAACTGGTTCACTTGCGCAGATCTCACCCAACGTCACTGCTGTCTCCAATGCTCTCGGAGCCGCCAAGGAGCTGTTTACAATCTT
AGATACACCCAGTGCCATCGATGCGGAaagagaagatgaaggtATCATCCCAGAGACGTGCAAGGGCAAGATCGAAGCTGTCAACGTCAATTTCTCGTAT
CTGAGCCGCCCCGATGCGCAGATCTTGCGCGACTACAATATTACAATTGAGCCTGGCCAAACTGTGGCGTTCGCGGGGTCcagtggcggcggcaagAGTA
CACTGGTTGCACTTTTGGAAAGGTTCTACGACCCGAACAGCGGCACCATTTACCTTGAAGGCCGTGACGTGAAGTCGCTCAATGTGAAGTGGCTGCGCTC
GCAGATCGGCATGGTTTCCCAGGAGCCGGTGCTGTTTGCGACGACAATCTCCGAGAACGTCGCCATGGGCGGCACCAACGTGACTCGCGAGGAGGTTATC
GCCGCATGCAGACTTTCTAACGCACACAACTTCATCATGTCGCTGCCGGAGAACTACGACACGCTTGTCGGTGAGAAGGGTGTGTCTCTGTCTGGCGGTC
AGAAGCAGCGTGTGGCCATTGCCCGAGCCATCGTCCGCAAACCCAGCATTTTGGttctggacgaggccacgAGCGCTTTAGACAACGAGAGTGAGAAGAt
cgtgcagcaggcgctgAATGATCTGATGGCCTCGACGAAAATGACGACGCTAGTGATCGCACACAGACTGATCACGGTCCGTAACGCAGACAAGATCGTG
ATGCTGAATGCTGGACATATCGTGGAAAGTGGCACCCATGACGAATTGCTGGAGGTCGAAGATGGCATTTATCAAAATATGCACCAGATCCAAGAATTGC
GATACAAAGACGGACAAGGCGAGGTAGTCAGGAGTGAGACGACGAACAACTTCATTCCTTACTCCATGGTGCCGCACACTAAAAGCGCCGTGTCAACGAA
GACAGACAGTTCGGAGAACGATGTGGAAAAAAATGCcctcgagaagaagccgtTTGGACTGAAGGACATGGCCAAGCTGAGCAGACCTGAGTTAAGCTAC
TACGTAGTTGGACTCGTTGGCGCAGCTTTCGGTGGAATTGCTACACCCGCGTCGGCATTGCTGACTGCAGGGATGATGACCTCCATGACGGAGAAATTTG
GACAATACGAAGACTCAGGCGACAGGGCCTACCTCAGTAAGCTGTACGACAGTGTGGAGGTTTATGGTATCCTCTACCTAGTTGGCGCCTCGGTGATCAT
ATTTTTCACGTACATGCAGACGTACTGTTTCAAGTTCATTGGCGAGAAGGCCACCACTCGTCTGCGCAACGCGAACTTCGAGGGTCTGTGCCGTCAAAAT
GTTGGAttcttcgacgagaaggagcacgCAACGGGTGCACTGACTGCTGATCTCGCCACGAACGCCGTCAAAGTTGCACTGCTGTCTGGTGATTCTCAGG
GCCAAGTCTTCCAAGGTGTCTTCACTCTCTTGGCTGCGTTGGTCATTTCGTTTGATTCGGTAGCTGGCTGCTCTCGTTCATCATGCTGGCAATTCTGCCA
TTCTTGGTGTTCGGCCATTTGGCGCGTatgaaggagatggagggCGGGGCAGTTGTCTCCAACGACCTAGCTGTCCCCGGGGCACACGCCTCCGAAGTTC
TCAGCAACATTCGGAccgttgctgctctcggcATTGAGCAAAAGTCTGTCGATGTCTTCGATGACCTGTTGGAAGAACCGCTCCGCAAGGGCCACAAGGA
AGCGCAGATCAACGGTCTATCGCTTGGCTTCAGCTCCTTTTCCTCCATGGCCGCGTACACGCTCATCTTCTGGTTCGGCGTGAAAAAGGTGAGCGACGGC
ACAGTTCCCTTTTCGGACATGATGCGAACTCTTATGACAATGATGTCGATTCAAATGGCTGGAAGCGTTTCCAAGTTTTTCGGTGACGCCCCCAAGGCCT
TCCAAGCTGGCTCGACCATCTTCGCTATCTGCGACCGAGTGACTCTCATCGACTCGTTCTGCCCCGATGGACTTCGCctggccaagatcgagggTCGACT
CGAGTTCAGAGATGTTGCATTCCGCTACCCGACGCGCCCCGACACCAGTGTCCTAAAACACTACAATCTCACTATCGAAGCTGGTGAGACCGTAGCCTTC
TGCGGACCCAGCGGTGGAGGCAAGAGCACCATCATCTCGCTCATCGAGCGCTTCTACGGCCCTGTGGCTGGCGAAGTTCTTCTGGACGGCTACAACATCA
AGGACCTGAACTTGAACTGGCTGCGTGGCCAACTCGGTCTCGTCGGCCAGGAACCCACGCTCTTCATCGGCACCATCGCTGAGAACATCTCGTACGGTCT
GGTTGAGCAGTCGAGCCAGCAAAAGGTCGAAGAGGCTACCAAGATGGCCAACGCGCACGATTTCATCACCAAGTTCCCGGACGGCTACGACACGCAGGTG
GGCCTGAAGGGCGAGCAGTTGTCGGGCGgccagaagcagcgcatTACCATCGCCCGTGCCATCCTGAAGAATCCAgacattttgctgctggacgaggcca
cgAGCGCGCTGGACTCGgagagcgagaaggtggtgcaggaggctctggacaaggtggtggcgttGAAGCGGCGTACGACGATTGTCATTGCACATCGGTT
GTCGACGATCCGCAAGGCAGACAAGATCTGCGTGGTGAGTGGCGGGAAAATTGCGGAGCAGGGCAAGCACCaggagctgttgcagctcaaCGGTATCTAC
GCTGGTCTGGTGGCATCGGCATCCCCGTAG