Description :
From Genome Similarity Track
Location :
contig_106:59331- 63072
Transcript NameFunction/comments
g13601.t1hypothetical protein

Sequence
3741 bases(100 bases per row)
ACTTGCTGATTGGTTTTGAGTCGGCCATGTGGTTTATGAGTCTGGATATGGCAAGTGGATTCTGGGCTGTCCTAATGACCGAGCGAGCCAAGCTGATCTC
TGCGTTTGTGTGTCCGTTTGGGCATTTCCAATGGATCCGGATGCCGTTCGGCCTAAAGAACGCCCCACTCATTTATCAAGCAGTCATCAACAACTGTCTG
TGGGGATTCGTTCGCCTGGATTCTGAGGAAGAAGCAAAGGTGGACCCTGACGTACTTGATTTCCTGAAACTTGATCCTCTGGAACCCAGGAGTCCTGATA
GTACTGAGGAGGATTTCTCGATCTTGACGGATAAGATGACAGTCTTCCAGCGTAACATCCCAGCCCCACCTCAGATGGGCCCTGTGCTCGGGCGCAGCTC
GTACATTGACGACATCGCTCATGGTGCACCAACATGGGATCACCTGTGTGAAGACTTGAACGCTTTACTGTTTCGGTTACGCTATTGGAATATCTCTGTA
AGTCTACCCAAGAGCGAATTTGGCAAGTTGTCCATCCCGTACCTCTCGCATGAAATTAGTGCTGAAGGTATCCGGGCGAAGCCAAAGATTGCGAAGGGAG
TCCAGGATTTGCCGTTCCCGAAGACACTCAAGGGAGTGCAGTCTTTCATGGGAAGTCTGAATTACTATAATAAGTTTATCGAAGACCTCCCCGTGATCGC
CGCTGTCCTATATGAGCTGACGGACGAACAGATACGTGCTGGACGAGACTTGTCGCGAGCCAAGGAAGCGTTTGAGATCCTGAAGCGCAAGATTGTATCG
ACTCCACTACTGCGGCATCCTGACCGCACACGACCATTTGTGATCATCCCGCATGCTAATCAGTGGGCAGCGTCTGCGGTACTAGGCCAAGAGTACGATG
GAGTCATTCATCCGGTTCGCTTCACGGGGCGTGTCCTGAACGACGCTGAGCTGAGATACCAGCTCGCCGAGAAGGAAGTGATTTCAATCATGCGAGTCCT
AGAAGTGTTCAGGAATCTGGTGGAACACAGTCCAAAGATCGTAGTATACACCCGATACTCTGTGCTTAAGTGGCTACTGACATCCAAGTCGGCAGACGGT
AAGAACGTCAAGTGGGGCGTAATCCTGTCACACTGGAATCTGGAGATCCGCAGAGTGCAACGTGATGAAGACGGACTACCTGCCATCCTAGATGCAGGAA
TCACACCTAGAGAACACCTGGACGAAGTCGCGGAGAATTTGATCCCGGCTAAGGGTCGAGTCGCACCAATAATTCCCATTAGTCTGGAGATGTTGGGTGC
TGACTTTGAAGGCCACATCCTGAGTTTTGACGGTGCCGCCAAGACGTCTACACGCCGTGGCAGTTGCGGATGCATTCTGTGGCGCCTCCCTGGATGGAAG
GTCCTAGATGCACAAGGATTTGTTTTGGAAGATGTGACCGTGAATGATGCTGAATACAGTGGGCTGCTCAAGGGATTGAACATGGTGTTAGAACATGACG
TCCAGGAGATCGTTGTGGTCGGTGATTCCAGGATCATCATCCAACAAGCACAAGGCTTGATCAATTGTCACCAACACACTTGCAATTGGTGTCCAAGATC
CACGAGAAGCTGATGAGACCCGCTCAAATCCTGGATGCGGGAGTGCAGGACGACAATGGCCAGGATGCTGATTCTACAAATCTCCCTGGACCAGAGTCCG
CACCTCTGCCACTGGCCGCCAAGGTGCTTGTTGCCGTAACTCGTGCACAAGCTCAGGATGAACCAGACCAAGGCGATGTGATGGGCCCGATCGAGTACCA
AGCGGAACGATGGCGACGTATTAAGCTGCATCAAGATAAGGACGCTTTCCTGATGCAACTCAAGAATTTCCTGAAGGGTGATGTAACAGAGATGTCACAC
GCCCAAACCAGGAAGCTTGCTAAAGTCGCCGATGATTTCGTGCTTGACTCTCGGGAAGTCATCTACCGCCTGAGTCGGTCTACCAGAGATCGCTCACGTG
ACATGGTCGACGAACTCAGACTAGTCGTGCCAAGGAGTCTACATTCAGATATGCTGCACTACGCACATGAGGATTTCCAAGGTGGACACCAAGGGATCAC
GCGGACGTATGAGAAGCTTCGTTCTGAATTCTACTGGTCCGGTATGTATGCCGATGTTGAGAAATTCGTCAAGGAATGCGTAGATTGCGCCAGCGGCAAG
GGGCGTCCTCCAAATCCTGGACCTTCGCCTGGAAACATTGAGCCCAGACGACCGTTCGAGGTTGTGTCCATGGATTTTGTGACGCACATGCCTAAGTCGG
ACCGCGGAAACACTTTTTTGCTCCTATTCCAGGACATGTTTTCGGGGTTCGTGATGTGTAAACCCATGAGTTCTACGACGGCCCAAGATGTCGCTGAAGT
CTATGAAGAATGCGTATTCAGGAGGTTCGGAGCGAGTTCTATGATAAGACATGACCAGGATCCAAGATTCATGAGTGAGGTCTTCACGCGATTCCGGGAA
CTCTTGGGTAGCAAGCAGCGAGCCACTCTGGCCTATCGCCCTCAAGCCAACGGCCAGCAGGAGAGATCTGTGCAGACTGTGGTGCGGAGCATCCGCGCGT
ACGTTGCGGAAGCCGACCAGAGTGACTGGGATGATCATGCAGAACGACTGATGTTCGCTCTCAATTCGGCATTTGATGCAACAAGACTGGATACCCCCTT
CTTCCTGGTGCACGGCTGGGACGCACACGGTACGGTGTCTGCTATGCTTGGACCCAAGCCGTCGAGCGTCCAGGAACGCACTGCGTATGACTGGCGTCGG
AAGTTGCAGCGTGATTACAGCTACGCTCAGGCTTGTGCCAAAGACCTGCAAAAGAAGGCTAAACGCATGCGTTCTGCTGAGCAGACCAGGAAATGGAAAG
AACTGTCCGAACGTTTGAGAGCTGGCTTCGCTGTGGGCGATGCTGTCTGGTTATATATACCGAAGGTGCAGCCTGGACTCAGCCGGAAACTAGCTCACAT
GTGGCATGGTCCATTCCGTATCCAGGAAATGCACGACGACTTCAGAGTGAAACTCAGGATTGAGAACTCAGGATATCGTGTTAATCCCTGGGTGCATGTG
AGTCGACTAAAGCCTAGAGCATTGTTCCCAAAGCGACCCGCTGTGGAAATAGACGTGGAGGAAGATGACGATTTCGACGCAGCCTTGTTACCAGAAGACA
GCTGGGAACCTGACGTAGAGAACGACGAGTATGAAGTCGAGCGAATCCTAGATTTACGCTGGACTAAGAGAACTCGGACATCAAGGCGCTCTCGCGAATA
CCTTGTGAAATGGAAGGGCTACGATGAAACGGAATGGTTACCTGTGTCGAGGCTTAACTGTGGTGCTCTATTATACGAGTTCAACCAAGGTGCGCGCGCA
AGAGCCCGTTTCCAGGCTATGCAAGCTGGAGATGATCATCCAAGGAACTAGTACCTTGGATGCAAGAAATTGCCCAAGATGCCAACACCCGGACCTTCAA
ATGCTGAAGTCTGGCAATGAACGCATTTTGGATTCAGATCGTCAAAAGTGAACAAGTCTGGGGATGAAAGTGACTTTGATTGAATTTTATCATGTATGAT
GTTATGGACTGCGACCTTTGACCAAGTGATTTCGAAAGCAAGGTGAAGAGAATGGAATTACGAGTGTGATTGTGAGAGGGCTGAAGTAAATGAAAAGACC
TGGATTGTATTAAGTGGAAACACTTACTGAATGCAAAAGAC