Description :
From Genome Similarity Track
Location :
contig_8:593239- 594730
Transcript NameFunction/comments
g1910.t1hypothetical protein

Sequence
1491 bases(100 bases per row)
GACTGCGCTCATCCTTCAACATGTTGGTCGTCGTCTTGAAAGCCTCAAATTCGATAGTCTTTTCCTCCAGCTTACCCCGACTTCGCTCCAGTTTCGACTT
GGTCTTCGCAAATTCATCGGCCAGCTTTTCTCGCTCTTCCTCGACCGACCGCAACTGCTCTTCGATTGTAGCAATCAAAGCTACTTTCTGCTCTAGCTGC
TGCTCCAGCTCTGCGATCTTGTCGTCCGCAATAGAAAGCCGATCTTCAAGCTCTGCCTTAGCCTGCATACGCTCTTGCAGCGTGGACTCAAGTCCTTGTT
TCGCCTCGTAGGCAACTTGAAGCTTCTGTTCCATCTCGATCATCTCAATCAAAGCTGCTTCGAATTCCCGACGTTCTGCGTCAAGAGAGGCGCTATTAAC
CGCGCACGCTGGGCCGCTCGACCTTGATACCTCCACCAATTTCTTCTCAAGAGCTGTGAGCTGCTGCTTCTGATCCAAGAAATTGACCTTAGCTTGGACT
AATGAAGAGCGCAATTCCTCGACCTCACGATCTTTCTCCTGCCACTCGTCCGGCTCAGTCTTGCTGTCTACCACAGCATTCAGCTCACTAATTCTCTCTT
CCAGAACGTCGTTTTCGGTCTTGATATCATCCAAATCCCGCTTAATCTTGCAGTTTTCCTTTTCAGCCTTGACTACAATGCTATTCAGGTCAGCAATAAC
AGAATGAAAATCTTCCTTTTGCATAGCAAAAGCCTCAAGTTGACATCGCAGATCCTCGGATGTACTCTTGAGATTCGACTCGAGCGTTTGGTTGTCCGAT
TTCAGAGGTCCAAGCTGTGCAAAAATTGCGTCTAGCTCGGACGTTTGCTCGCGGTGCGTCTCCAGTAACGTTTCGTGATCTTGTTTGAGTTTCGATACAC
CATCCGCCGTCTTCGCTACCTCAAAAATCATGCGCAGATTTTCAGCTTTGCACGCGGCCATTTCTGCCTCGACAGCATGTAGTTGAGCCTTTGTGGCTTC
CAACTCACGTTCGAGGTTAGAGTCTCCATTGCAGCTCTCGGCTGTTTCACCATTCGATGAAACCGAGGCAGCATCCTCCCCTGATGATGTGTACTTGTTG
GTGTCAGAGCAATCGTCGAGGCCTCTAACAGCCAGTTTTTCAATCTCCGAGGCACGCTCCTTTAGAGCAATTTCGCAATCTTCCAGCCTAGAAACAAGCT
GTTGGTTCTCCGCCTCGTATCTGTGTATCCTTTCCTGGAGAATGTCTGCTTCGCTTTGACGGTGCTCCATTTCTGGCTTCGCCACACCAGCGAGTTGCTC
CTGGATATGGTCCAGATAAAACTCGAGTTCTGCTAATCGGGAGCTACGACTGACATCACCATCAACCTCGGTGGGTATAGGTTTGGTTAATCGTAATGCA
GCAGCAAATGCCTCAAGTTTGTTCTTGATCGCAGAGAAATCGTCGAGTAGCTGCTGTTTCTGAGTGTGGGCATCCTCGAGCTGTGTAATCA