Description :
From Genome Similarity Track
Location :
contig_8:593239- 594728
Transcript NameFunction/comments
g2049.t1hypothetical protein

Sequence
1489 bases(100 bases per row)
ACAATCGACTGCGCTCATCCTTCAACATGTTGGTCGTCGTCTTGAAAGCCTCAAATTCGATAGTCTTTTCCTCCAGCTTACCCCGACTTCGCTCCAGTTT
CGACTTGGTCTTCGCAAATTCATCGGCCAGCTTTTCTCGCTCTTCCTCGACCGACCGCAACTGCTCTTCGATTGTAGCAATCAAAGCTACTTTCTGCTCT
AGCTGCTGCTCCAGCTCTGCGATCTTGTCGTCCGCAATAGAAAGCCGATCTTCAAGCTCTGCCTTAGCCTGCATACGCTCTTGCAGCGTGGACTCAAGTC
CTTGTTTCGCCTCGTAGGCAACTTGAAGCTTCTGTTCCATCTCGATCATCTCAATCAAAGCTGCTTCGAATTCCCGACGTTCTGCGTCAAGAGAGGCGCT
ATTAACCGCGCACGCTGGGCCGCTCGACCTTGATACCTCCACCAATTTCTTCTCAAGAGCTGTGAGCTGCTGCTTCTGATCCAAGAAATTGACCTTAGCT
TGGACTAATGAAGAGCGCAATTCCTCGACCTCACGATCTTTCTCCTGCCACTCGTCCGGCTCAGTCTTGCTGTCTACCACAGCATTCAGCTCACTAATTC
TCTCTTCCAGAACGTCGTTTTCGGTCTTGATATCATCCAAATCCCGCTTAATCTTGCAGTTTTCCTTTTCAGCCTTGACTACAATGCTATTCAGGTCAGC
AATAACAGAATGAAAATCTTCCTTTTGCATAGCAAAAGCCTCAAGTTGACATCGCAGATCCTCGGATGTACTCTTGAGATTCGACCCGAGCGTTTGGTTG
TCCGATTTCAGAGGTCCAAGCTGTGCAAAAATTGCGTCTAGCTCGGACGTTTGCTCGCGGTGCGTCTCCAGTAACGTTTCGTGATCTTGTTTGAGTTTCG
ATACACCATCCGCCGTCTTCGCTACCTCAAAAATCATGCGCAGATTTTCAGCTTTGCACGCGGCCATTTCTGCCTCGACAGCATGTAGTTGAGCCTTTGT
GGCTTCCAACTCACGTTCGAGGTTAGAGTCTCCATTGCAGCTCTCGGCTGTTTCACCATTCGATGAAACCGAGGCAGCATCCTCCCCTGATGATGTGTAC
TTGTTGGTGTCAGAGCAATCGTCGAGGCCTCTAACAGCCAGTTTTTCAATCTCCGAGGCACGCTCCTTTAGAGCAATTTCGCAATCTTCAAGCCTAGAAA
CAAGCTGTTGGTTTTCCGCCTCGTATCTGTGTATCCTTTCCTGGAGAATGTCTGCTTCGCTTTGACGGTGCTCCATTTCTGGCTTCGCCACACCAGCGAG
TTGCTCCTGGATATGGTCCAGATAAAACTCGAGTTCTGCTAATCGGGAGCTACGACTGACATCACCATCAACCTCGGTGGGTATAGGTTTGGTTAATCGT
AATGCAGCAGCAAATGCCTCAAGTTTGTTCTTGATCGCAGAGAAATCGTCGAGTAGCTGCTGTTTCTGAGTGTGGGCATCCTCGAGCTG