Description :
From Genome Similarity Track
Location :
contig_106:59314- 60671
Transcript NameFunction/comments
g13089.t1hypothetical protein

Sequence
1357 bases(100 bases per row)
ACATCAGGATGTGCATCGACTATCGTGTGGTGAATGAGTTTATCAAGTTACTGCACTACCCTCTGCCACTCATTGACGACTTGCTGATTGGTTTTGAGTC
GGCCATGTGGTTTATGAGTCTGGATATGGCAAGTGGATTCTGGGCTGTCCTAATGACCGAGCGAGCCAAGCTGATCTCTGCGTTTGTGTGTCCGTTTGGG
CATTTCCAATGGATCCGGATGCCGTTCGGCCTAAAGAACGCCCCACTCATTTATCAAGCAGTCATCAACAACTGTCTGTGGGGATTCGTTCGCCTGGATT
CTGAGGAAGAAGCAAAGGTGGACCCTGACGTACTTGATTTCCTGAAACTTGATCCTCTGGAACCCAGGAGTCCTGATAGTACTGAGGAGGATTTCTCGAT
CTTGACGGATAAGATGACAGTCTTCCAGCGTAACATCCCAGCCCCACCTCAGATGGGCCCTGTGCTCGGGCGCAGCTCGTACATTGACGACATCGCTCAT
GGTGCACCAACATGGGATCACCTGTGTGAAGACTTGAACGCTTTACTGTTTCGGTTACGCTATTGGAATATCTCTGTAAGTCTACCCAAGAGCGAATTTG
GCAAGTTGTCCATCCCGTACCTCTCGCATGAAATTAGTGCTGAAGGTATCCGGGCGAAGCCAAAGATTGCGAAGGGAGTCCAGGATTTGCCGTTCCCGAA
GACACTCAAGGGAGTGCAGTCTTTCATGGGAAGTCTGAATTACTATAATAAGTTTATCGAAGACCTCCCCGTGATCGCCGCTGTCCTATATGAGCTGACG
GACGAACAGATACGTGCTGGACGAGACTTGTCGCGAGCCAAGGAAGCGTTTGAGATCCTGAAGCGCAAGATTGTATCGACTCCACTACTGCGGCATCCTG
ACCGCACACGACCATTTGTGATCATCCCGCATGCTAATCAGTGGGCAGCGTCTGCGGTACTAGGCCAAGAGTACGATGGAGTCATTCATCCGGTTCGTTT
CACGGGGCGTGTCCTGAACGACGCTGAGCTGAGATACCAGCTCGCCGAGAAGGAAGTGATTTCAATCATGCGAGTCCTAGAAGTGTTCAGGAATCTGGTG
GAACACAGTCCAAAGATCGTAGTATACACCCGATACTCTGTGCTTAAGTGGCTACTGACATCCAAGTCGGCAGACGGTAAGAACGTCAAGTGGGGCGTAA
TCCTGTCACACTGGAATCTGGAGATCCGCAGAGTGCAACGTGATGAAGACGGACTACCTGCCATCCTAGATGCAGGAATCACACCTAGAGAACACCTGGA
CGAAGTCGCGGAGAATTTGATCCCGGCTAAGGGTCGAGTCGCACCAATAATTCCCAT