Description :
From Genome Similarity Track
Location :
Scaffold_2336:593- 3269
Sequence
2676 bases(100 bases per row)
GAGAGGCTCATACTCCGAGTAAGAACAGcacgtgagcagcagcgagcgccgATTTTGTCGGTGCGGTTGCCATTTCGTGGAGTTTCGTGCCCAGTGCCTG
GATAACTCGGGGATCAAGTCGTTCAAACTGCTGTCGATCAGTCCTGACTTCTGCAGcccattgctgcagccactgcagcgccaaccaTACATCGGATGAG
TTGTTTGCTTCATCACCGTCTAGAAGCGATAAGAACGCTGTGCACAAAGCGTTACACGCCACGGATGACAGCTGCATCATGCACGGAGTTTTTATCATCG
ACATCGTGCGTTGTAGTAATTCCAAGTCATCTTCGACTATGCACAAACGGAACGCGAGTTCGTACTCACCACACTGCGCCGCTTCCAAGGCAGCCTCTCC
CCGAGTGAGCTCGAGGTCAGTGGCATTGTTGTTGTCACGCTTGTTTACACTTCTAAGTTCATTGTTGGGCTGAGGTTGCCTGAGTCCCTCGGGCGGATCA
ATCGCTCGAGGCGGTCGACGCTTAGGGAGTGAGATCTGAGGAATATCTTGCTGTGAGGTTCGACGTAAACGAGCCTGTGCTCTTTGCTTCGCTGCAAATT
CTTTCAAAGTTGTGACAGCATGCATAGCATCGGATAACGTCGAGAATGAAGGCGCAGGTGTTTTGACCTGCTCTGCTGTGAACGATTCCCTAGTTGCCGT
CGAAATCGGGCGCGTAGGTATACCAActtgctctgcagcagacgcttcCAAAGCCACTTTGCGCACCCTAGAACTATTACTCCGCATTTTGGTTGGTTGG
TCAAAGCTGCTCTTGTCGTGTTCTGATGGTAGGTGCTCATCTTCACCCCCATTTTCTGGTGCAGCATGATCCATGATCAGATCTGTAAATCTCTCGTCGC
CTTGACTGTCTTCTGCAGACGTCTTCTCTCTGTTTTTCCTGATGGTTGATTGACGCTTGAGTTGTGCCAAGTCGTCATTTTCAGTGGTAATATCATCATG
TGAGGGTAAAGCCTCATCGCCTTCCTCTTGATTGTTAAAATTTAGAacgtcctcgtcttcttcggtcGCGTCGGCAGGTAAAGATTCCTTTACGTCGTTG
GTACCATCGTCGACAGGTTTCGCCCACTGTTTACTCGTAAATGAGTAGCCTGGAGGGTTGGGCGGGACGAAATCGTAATTGGGATTTACATTGGATCGGA
CTTCATCAACCAGCCGTGGATAGATTTTTTCGAGACAGTCAAATGCTAAGGCAGCCGGAATAGCAGCTTCGCGAACAAGAGAGGCAGAATCGTGTCGGCC
GGCGAGTACGAGAGTTCGAACTCGTTCCTGGAGATAACAAATTGGTGAGTCTCAGATCTTCCACTTACGATTCATCCTCGCAACACCTACCAAATTTAAT
TGAAAGTACTCCTTCGTAGCTTCAGCGGAGGTGAACCAATCTGACTCTTGCAGTACGAATATATCGAGCATCATGGTCAATAACTCGAGTCCTCGTTTAC
GCAACATCCACTCGCTGCGAGGGCTGCACTGGAAGACATCTTCGATTGCCTCGTAGATTGAACCAATGTACGGGGCAAAGTCGTTACCGAGCTGCGTGAA
ATTGGCTTTCTCGTGAGCGTCTCGAGCTAACTGGCACGCCGATTGCAATAAGAGGAACGAAGGCGAAAAGGCAGCAAACATCGTACTCCCATCCACCTTT
GCTACGGTGTCTGCTACTAGAGTTTTGAAGAATGATCGAATCCGAGTCGCATGAGCCAGGATTGTACTCGAACTAGGCACCGATATTCCATCAAAATCAA
CTGGGTGGAGAAGGCCACACAAACACCTCGTAGCTGCCTCGCCCACCGCATTTGTCTCCCTCGCAAGCATagcagcaactgcttcgAATGGATTACTGCT
ATCCCCACGGTTGCTAGGACCCTCATCTCGTAGAAGGGAGACAGTGGGGCATGGCAGGACATAAAGCGCAACAGCCGACATCAATATCACGCACGCGTCA
GTTGTCTTGGCGTGTCTGTCACGAAGTCGGAGGCACGTGTAAGATAATATCCGCGGGAGGAGTTTTGCTGATTTTACTGGTTGGCATCTACATAGCGCTG
CGATGAGAAGTACGAGCATGCGTCGAGTCGATGAACGACCAGGTTTCTTGAAGCCAGTATGTTAGTATCTTTGAGCGCGTCTATTGACAATGTCGAAGCA
AGCATGGTTTACCTTGTTTTTCTCGATTAGTGTATAAAATTCTTTCACCAAAGAAGAATCTAGCCCCGGTAAGGATTCACTGCGAAAAGAAGAATCACCA
TAGCATCAGAAAACATGTTATATCCAAGTATTTCAGAGTCAAATGTTCACATGAGTGTTGCGaatgcttgctgctgtgtgtcTCGGTCTTCCAGACGTCC
GATTAGAACGTTTAGGTTGCAaatttcttgagcttggcgtTCCTTAGCCTTCCGTTcctgcttctttttctttaTCGTACCTTTTGGGCTCAAACATTCC
TGTAGAGACCCAACACCGCTCAGCTTCCCAGTATGCCCAGTTCCCCGTCGCCGAAAATTGGATTCCATCATTGTTAGTAAGGTGTAACACGATTACAGCA
ATTGCAAGCAAAGTCGAGGAATAACCATCGCCGTAAGCACTACCAAAAGTATTTACAGCATCTCGACAAAAATACT