Description :
From Genome Similarity Track
Location :
Scaffold_3642:593- 2480
Sequence
1887 bases(100 bases per row)
CCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTTGTGGATCCGATATCTCTCGGGCCAGAGCTTGTTGGATTTCTATCCGGAC
AGCTGGAGTGGTTATCGCAGCGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAA
CTTCCCAAGAAGGATTGCATCGCCCGTATAGACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTTGGATTCGCCTCCAATCCCTCCTTGGAAA
CTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCAC
TCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCC
CCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACTTGTTTCGGACTTCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGC
GTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATC
CGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTATCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGA
TACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTTTTCTTGATGATGATTACCACTGGGGATGCCC
ACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTG
AGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCC
CAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCT
CCGAAATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCAT
TGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGGTACCCTGGTATCAGGAAAACCACAAGTTGGATCTAGTCGG
TCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTT
GTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGT
CCTGGATCCAACTTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTG
GCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACAC
ATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGAC