Description :
From Genome Similarity Track
Location :
contig_29:59291- 60646
Transcript NameFunction/comments
g6729.t1RAW25146.1 Aminoacylase-1 [Phytophthora cactorum

Sequence
1355 bases(100 bases per row)
GCTTTTGCAACGTCAGCTCTCGCAACGAAAACGGCTACGGAGCAATCGAGCAACTCGCCCAAGAAGTGCAAGGAAGCCGCTCTCGGCGGCGAGTCATCGC
CAAAACTTCAACAACGCAACTTCAGCTGTGAGCATGGTCGAATCACGTGCAGGCCCTGTTGGTTTCGAGACTTGGACAATCGGTCCTCGCAGCTCGCTCA
GCGCTGTGCCATGTGACTTTGGCAGCCAACTCCAGCACCGCGATGTAGAGGCGCCTATGATTCCAATGATAAAGCGCTTGGTATGGTGGTCAGTAGCAAA
GGCTTTGCCAACTAACACGGACTTCTGTCAGCTTCTTGAAATGAAGGCTGCTATCTAAGGCATTCTACTTGTGAGCGAACGTGTAGTCTCATAGACCTTG
ATGCCATGCAGAAAGGAGTATACTATTTGCTGTCCTTCCCTACATCTGAGCTACTGGCAGGCTCGATGGGATCGATACTTCACTTTGCTTCAGCATACGC
GAACATGCGGCGGAAGAGCGTCTCGTACACGTCGATGCCACGCAGGAAGGTGTCCTTGTGCAGACGCTCGTTGTGCTCGTGAAGCAAGATTTCCGTCTTG
TTCATCGGAGAGAACCCCAGGGCCGGGATGCCGAGCTGGCGAAGGAAGCGGCTGTCCGTCGCGGCTGGAAACACCTCGGTCTCAACGGGAACACCGACCT
CCTGCGGCGCAGAAAACATGGTCAGCTCAATGCGAACGGTGCCGTTCTCACTACCTGTTCGCTGAGGATGACGACTTACCTCGCACCCTTCCTTGAACAG
TCTCCACCAAATGTTGTCGTCGTCGACCGACGTCGTGTAATGCTCATGCAGCGGGTTCTTCCACCACGATACGAACTCCCACGAGAGTCCTTCAGCAGAG
CACCATTCATCAAGCATCGTCTGCAATGCGCCAACCAAAGCCACGTTAGCACGAGACCCGTACGCAGTCCACTCCACGTCCACGACAGAGCGCACCTTGA
ATTTCTTCAGGTCCATGTTGGGCGAAATGCGGACGTCAAAACCAGCAACGGCCTCGGTGGGGATGACGTTGAGGGCGTGCGTCTTGCCACCGTCTTGGGA
CACGCCACTCTGCAGCATGTTGAGATTTACCGTAGTCACATCACCAAGGTTTCGCTTCTTGATATCGCCGTGCTTGCACCCCGAGTCTGCACTCAATAGA
GCTTCTTGCTCCGCGCGAAATGCCAAAGCCTGCAGCAATAAACAATTTTCAACACTCGCAGCTCGAAACAGCACGAACTTCGCGTCGGACGTAGAGCACT
ACCGACCTTGTTGCAGACATTGATGATCTTTGAAGTCGCCGTGTTCTGGATAAAA