Description :
From Genome Similarity Track
Location :
Scaffold_117:59285- 61235
Sequence
1950 bases(100 bases per row)
ACCACAATCTTAATGCCACCCATACAAAACTGAAGAGTCGCCGTATCTAAAAGATTGCATCGAGACTGAATACAATTTTCACATGCGGGAATGGACTTAT
AAGACTCGCTTTAGAACTCACCGCTGGAAGTAAGTCGGTCTGCGCGGGTCTCAACTGTAAAATTGTGGTCTCAAAGACCCTGTTACGTCTTAGGATAAGA
CCCACCGCAGGAGATACTCTAAGTGCAATTTAAAATAATAGGACGAAGGAAAACATAGTCTCTCCCTTTAGCCACAAGCGAAACGACTAATTATTCACAG
AGCTAGAGGTGTTGATTACCGGACGTACTGCTGCGGTACTAGGGCTTCAGGTAGGCCAGGATATGTAAATGACCGCATTTTGTTTTTCAGAAAGCCGTTG
CACATACATAGCTTATTTAACTACCTGACAGTAGCCGAAAAAAAGCTAAAATATCACTCAAACCAACGCTTACTGATTCTCTTATCCACCATGTCATCGT
CCATAATAAAATACAACCTGCTCAACATGAATTCAATCAACTGGGCACCGTTAATGGTGATCATGCAGTAAGGAGATCGCTAACTGAGTAAGATGGAATC
TGTACTTCCAGCCGACCGATCAAGTGCACGAATTAAGACCGTTTGATACTGAATAGGAAGGTACAAAAATTCATTTGGTTATACTTCGGTAGTGTGACCC
GTACGACCCAAGGGCATCTCCTGAGCCTGCTTCGCAGCCGCAGCATCTGCCCAGAAATTGCACCGCTATTAGTAAGAAGAAACTGATTTACAACATAACA
CACGGGAAGTTGGGGATTGTAGCAAGCTAGCCGACCCCGACGATCTTAACGATGTCGATGTCGATGTCGTCTACGTAGATGGAGCCGCGATTCTCGACGA
TTCCAGTCGAGTTGAACGGGGTACCGAGCTCCATCAACTTACTGGAGCGCGTTCTCGAGAGACGGCATCACCTCACGGCTCCGGAGCTGAAGCTGCCTGC
GCACGAGGCCTGAGTCGCATAACCTCTGGGACTTCACTAATGATGCCGGACATAATGGCTAATCATGTAGCTGACAGTGGCCGATGCTTTCGTCGCAATG
CCTAACTAATAAGTCGTCACCGTCGAAGGCGGGATCCCGTCGGCATGTTGTTGGAGCTAAACAAAAATCCGATAGATGTCGCTTGAGTGGCAGATAAACT
ATCTATCACAGGTATATATATGTGGTGGAGCAAGAAGAGAATTTTCCGAAGTCTGAAGCCATCCACCAAGATCAAGTGTGATCTCCCCCGAGAGTGACAC
CGACCTCCAGAAGAGTGACCCCCGTCGAAGATGATCTAGACCAGGGGATATCTGCTTGAGAAGGGGTGACGTCGATGCCGGGAAAGGAATGATGATCTTG
TATCCGGATTACGTCAACGTCCAGCAGAGAGTCGGTGGCGCACCACGAAGGCCGAGGGAACCAGCGAGCATGCGGTTGGACCACAGGAGCGTGAGAGAAC
GATGGGACAAGGACTTAGGCAAGGTTAACATTTAAACAGAGTTGATTTTACCCCTTCTTCACAAGTGGTCTTCGCCTTCGCAGTACCGGGCACGGGATAT
ACTTTGGCCCACCCGACGCTACGCAAGTCGACTTACGCCCCAAGATCAAGGAACCTCGGACGCCAGGATAGCTTGGCCCAGCGTCCGTCAACCCTCACTT
CGACCCACCGCTAGAGGAAGCGGCAAGCAAGGAAAGGCAAGGAAGGTCACACACCGACCACAAGGCAACCCCAGGCCAAGATCACACCTGGCCGGCGAGT
GTCGATCTAGACAACCCCAGATCGAAACAGCCACAACTACTCCGGCACAGCGTGAAGCGTATCCGCGTTGCTGCCACAAGTTCCCGCTGTCCACCAGACA
GTCCAAGACTCAACCCCAAGCACGTCTTCTCGAGATCACCCGAAGAGCGA