Description :
From Genome Similarity Track
Location :
scaffold_130:59256- 61449
Sequence
2193 bases(100 bases per row)
CGCAATGGGTAAATTCCCACCTTCGATCTTCCGCTCAGTTGCTCCCCCCTTCATTTCGCGTTTAGCTTCGTTCAAGGAATGTAGTTACCGGCAGTGATGA
AGTGTTCGTAAAACGGGTGTGACTTCGATCGACGACGTACCCGTGCGCCATTTGCAGCCGCCATGTTCACCACGTATGCAGCAATGAACTATGTGTGGAT
GCACCTCTCTCGAAATAGTACGTTTGACAAATATGTTTAATGATGGGGCCATGATTTTTTACCTATGTATACTGCTTGGTTTGTGGTGTACCAGTTTCTG
TAGTGAAGTCTGTGTTCGCCGTTATCGAGGTGTCGACGGTGCTGGGTACGAATCAACATTAAGCAGTATTTCCGGTATTTTAGGCCATAGTCCTTAACGT
AACGCCGAGCTCTGATCCAGAGGAAGTAGGACAAAATTTGGACCCGGAACCCGAGGCAGAAGCAGAAGAAACACTGGAGAATGGCATTCCCGTTTCCATT
ACGCATCATGTTCAGCGTGGGTCGGACCCGGTTTGGAAGGTCAACCATCGCCTAGACAGCCCAGTCAAACGTCGCAACGCCATATACACTCATACATGTG
TGCTTTGTGCTGGAGACCCAAAACTAACGTGGAAGCAGGCGCTTTGCCGGGTAGCATCAACCTCCTATGCCAAGTCGCACATGCTCAAAAAATATCTTGA
TCACGAGATTGGCGATCAAGAGCGCATACTCCGCGAAGAGGTTAGCAGTCATATTGTGGCCAAGACAAGTCCAGCCAATTCAACGAAGAGAGACGCTCTT
AGTAGTAACAGCCAGTCTAAGGAAAAGCGACAGAAGCGGTTGTGGAAGGTGACTTCGAAGGAGATAACATAACATAATTCGAGGTGGTTGATTCGGGACG
GTACGCTAGAAGCCATATTATACAGGGTTACTGTCTGCCGCTAGTAACTCGTATAACTCTGTTTGGTAGGACTACCGTACAACATGGTAACGACATCAGC
GTTTCGCTCTATGCTCACAGACCTCACGGGTGAAAAGGATGTTCCTGTAATGTCTTCGAAGACGTATAACGATATTATCAGCAGTCACCACGTCAAGTTC
CGTGATGATACTCGAGCACTGCTGAAAACAGAACACGATGAGCTGCATGGCACCCCCTTCATGAATATCATGCACGATCTTTGGACAAACAGCTCCAAGA
CCGATATCGTGGGGGCATCGATATCGTTTATTGATCATACGTGGCAATTCCGGCACTTAGCACTTCTGGCTGTAGCCAAAACCGACGGCCATGACTCTAT
CGAGGTGGCAAACCTACTCGAGTTGAAGCTGAAATAATTGTTTGATTTGGGGGTGACGACTATGGTTAGATTTGCGGTATCGGATACGGCACCTGCTGCA
CGCAAAGTCTCGAAGCAATTTGATACGACAATTCAGTCGGGTTGGTGTATGCATCACTGAATCTTTGTATCGGTTATGGCGTGGGGTTGAAGGAAAATAC
GCGGTCGGTGGAAGAGATCGACCCTAAGAGGGTCAAACGGTCGGTAGTGGTGACTCAGGGTGGGGAGTTTAAAGAGGGTGGGATGGCTATCCGCAAATTA
CGTGCTCGAAGCAATTACTGTGCTTCCAGCGTCTCAAACAAGTGCAGACGTTCCACAAGCTACCTCAATTAGCCGCTCTGATCGACATTGACGTGCGTGT
TGCATCCGTGATCAAGTTGCTGCAAAGATCTATTGTGAGCTATCCCGCATTTCGTGCGTACTTCCCGAATCAAAGCGAAGACCAGGAGAAGAATGTCTTT
ACCAGCATCACAGCCTCTGAATTGGATTTGATTGTGGAAATGGAGGCGATTACGCAGCGCGTAGCCTCGCTTGCTCTTGTGGAGTCCCAGTCAACCACCA
TGCTATCGGCTACGATGTACGTGATATTGAGAATCGCATCAGCACGTATCAATTCGTTCAAATTTGCAGCGTACAAGCTTGATGGCCTTGGCGACGAGGA
TGCAAATGAGCGAACTCTTTCCCGTGGAGAACTACGATTCGACAAGCTGTCCGATCTTGGGCACCGTTGTATCAAGCGAACGCTACACCAGATTGCATTT
CGGCTACCAGCACCGTCGATACAAATGGACATGGCACTGCTACTCGACCCACGAACTAAGAAGTCCGCAAAACAACTGCTCAGTGTCCCAGAT