Description :
From Genome Similarity Track
Location :
contig_25:59254- 61407
Transcript NameFunction/comments
g6061.t1hypothetical protein
g6062.t1XP_009517210.1 hypothetical protein PHYSODRAFT_323385 [Phytophthora sojae

Sequence
2153 bases(100 bases per row)
GTGGTGGTGTCAATGACAAAGTCCGCGGCGTCGTTGGCGCCAGTCTCCAACTCAACCGTCGAGAAGGTCAAGCGGTCGCCAGCCTTGGACGTCGAGAACA
CACCCGCCTCGTTCCCCGACAGGTGCAGGTGGCCATTGTAGATAGTATCGCACGTGGCCTCCGAGCACACGCAGACCCCCTCGAGATCCGCCTGGAATCG
GTCCGACCACGACGTGCAGTTGTTCGTCGCAGCATTCGCGGCTTGCAGCGCGAGCAGTGCCAGCGCGTAGCTGAAGGGATTGATAACCAGCATGCTCCGA
CGTTCGGGTGCAGGGTACGTTGTCTCGACCAGGCGAGTTGGGAAATGGTGTGGTCAATGACATTGACCACCACCACCCCGCCCAGAAAGCTCGCGAAAAA
GCGCGCGAGTGTATCCTTGCGAGGCTATAGATCCCACTCGGCGCACTGCACGTGTAGCAGATTCAGCTTCACAGACGAAATTGAAGGCGTTGCACACGCC
ACGCTAAGTGTTTTGGACTCCAGCACTCCATCTACAGGAAACGATGGCCAGAATCAGCTCATTTCGTAATCGATCCGGCAGAAATGATTACCACTGCGGA
GTGTGTCCACTGACACCTACGGTACTTTATTTGATGTCGTATACATAACATAACCCTTTGTAGCTCTCCTAAGGCCTGGAATACAGTAAGCGCTCTCTGT
TCCGGTACCACTTATAAAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACAGCTTCACTTATGGCGGGAATCGCCACGCACCATT
CATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCTCCGCCCCATGGGCTGGATGAGGATAGAGCAGAAGAGAGGTCTTATCAAGAAG
GCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGCTACCTACAAGCTGAAGCGGGCGCCAGCTCAAACAACCATTTCCGACA
TCCTCAATATGGCCCCGACAATCATGAGCAAGGCGTATGTGGACGGCAAGCGGCGCAAACCGCTGAAGGTGACCTCGGAGGCGCTGGAAGAGCGCCTATG
GGAGTGGATACAGAAAGTAGAGGCGCAGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAACGCGAGATTTGCAAAAGGAGCTATGTGATGCTTGG
GAGCTGTTCATTTCGGACGGGTGGCCCACTGCGTTCGAGCGCAGGCATGGTCTTCGTTCTCGCTCACGACCTGGAGAAGCTGCATCGGTCGACCCTGAAG
TCGTTGGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACCTATACTCTCCCGAAGACGTCTACAATATGGACGAGACGGGGCTGTGCTACGCAATGGC
CCCCGCTCGATCGATCTGCACAAAGACATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAAATGCTGATGGATCCGACACGCTGCCGGCAC
TCTTTCTTGGTCACGCAAAGCAGCCCTACTGTTTCAACAAAAGCACGGCGGCACAACTAGGCTTCTTGTACCGCTCGAACAAGAAAACCTGGATGACAGG
ACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCGTGCGAAGAGCCGTCAGATCATGTTGCTGCTTGACAACGCACCGTCCCACCACTTG
GGCGATATCGTGTGTACTAACGTCCGCGTAGAGTTCCTGCCGCCGAATACCACGGCATTCCTACAACCCATGGACGCAGGAATCATCGCCGCGTTCAAGC
GCGCGTACAAGGGAAAACAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTGTCGACCAGCTACAGACAAT
GCAATGGAGCAAGGAGATCTGGCTCGAACTACAAGGTAAGACCACCATTCAAAACTGTTTCCGCCACACTGGAATAGTGTTTAATGCTGTAGATGAGAGG
GACAAAGAGGACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTCGGGCTTCACAGTTGAGTCTTTAAGTAGCCGACGATAATGCACAGCAA
ATCTTAGGATAGGGTCGGACCACGATACCGGAATTGGGAGCATATGCTGTACT