Description :
From Genome Similarity Track
Location :
Scaffold_24:59253- 61769
Transcript NameFunction/comments
Phyke_g1566hypothetical protein

Sequence
2516 bases(100 bases per row)
TGAGCTCCCATCACCCTGTAGGTCGTCAGAGCCCAGCAATGATTGCGACAAATCCAAGTTCAAGAAGTCTGAAGACTCCCCTAGGCTCATATCGCCGCTc
atgcgctgctgctgctgttgctgctgttgttgctgctgttgctgcggttgttgctgttgttggccAGCAGGCCCATTTACAGCGCCTGAGCGATGAGCct
gggcttgagcttgtgcacGAGCTTGGgcttgcgcttgctgttgttgcatgTAGTTCGGGttttgccgctgctgcatctgctgttgcatctgttgctgctg
ctgctgctgctgctgttgttgttgcatctgTCGCATGGAGTTCTGGCGCTGAAGCGCCTGGTtctgctggtactgctgctgttgaagcgagTTTTGACGT
TGCatctgcgcttgctgctgtgcttgctgcatttgaagctGCCGCCGCTGCAATTGGGCTTcttggaactgctgcaattgctgtgGGGTAAGCTGCTGCC
GCATCTGGGGGTTctgttgcatctgcatctgcaagtgttgctgctgcatcatctgtTGCTGGGTCATCCGGTTACCATAAGGCATATTGCCTACTACGTG
CCCTTGGGGACCCATGTTGCCTGGCCCCGGGTTCATCGCCATACCAGGAGGAGCGTTTCCTGCCATCATAGCTGCGTTGCCAGTCgcacctccagcattt
cCCGGTATTACACCACCAGCTCCCGCTCCTGCGCGAGGGTTGCCACCAGCCTTGTGCTGTGCACGTGCACCCATCGTCACCgccaagtgctgcagacgtg
TCTTTAATGAAGAAAAATCTCCGTACTCGTCCCGATTTTTTGCCGTGCGATACAGTGAGTCCTCTAGTCGACGAGCCATATCAGGCAACCGTCGAATCCA
CTCAGCCGGTGCGTCCGGTTTTCGCTGCTGTAACAAACTAACACTGCAGAACAAAACAGTTAAAGCAATTAGTATCTGATAATCACTTCATGCAACCGCG
CATGACACCACAGAACGTACATTTTTCCGATCATCTTACGACGCAGAGGAAGATCGTTTTCAGACTGCCAGGCGGCCTGCGAGTCAGCAGGATTGCTTCC
GCCGGGCGTTCGTCCAGCCGCAGCGCGCTGCtgagcctgctgctgcgccatcTGAGCCGACCGAATTCGCGCCGCATTCATCATGTTCGCCTGCTGCGCG
TTCTGCTGCGGTCCTCCCATCATCATGTTCGGGTTGCCATACTGGCCATACGCAGcatttccagcagctcctcgagcCATGCCCGGGCCTccacgctgct
gcatgtaAGCAGCATTGGCTCCGGCCATATTCTGCTGATTAGCACTTTGACTCATCGAGATCCGCAGCACTTCCATTGGAGGAGGAATCAGGTCCGGATG
CTGCATCATCATGGCCTTTACCCGCGCAAACTCCTCATCATACGAGGACGTCGGTTGTCTGTAGCCCTGTGCCTGCGGCCCTCCCATGTACTGTCCCGCC
GCGCTCGTAGGTAACGCCCCACTCACTCCAGCCATCTGCCCGGCGTGCATTTGCTGGTACGACTGGAACTGTTGGGGCTGTCCACTCTGCTGattcatca
tcatctgaTTAGcatattgctgctgtctctgctgcatctgcatctgctgttgttgctgctgctgattgcCGATATGCGGCCGTGCCGATGACGTCGTGGA
CGGAGCGGACGTCGCagctccactgctgctggtattAGCAGCACTGGTGGTCGGAGCTTGACTCGCACCTTGGCTCGTGGTCGGGCCCGCCGCAGAGAGC
GAAGGTTTAGCTGCTGACGACGTAGTTGACGTGGCAGTGGATGACGTTGCCTCAGTCTTGgctgttgatgatgttgtcgcTCCTGTactggaggaggcag
cacTTGATGGTGTAGGTACCGTGCCTGTCTCtttcttgggcttgttgTCCTCGCTCTTAAGGTTCAACTTACTCTTGTCATCtgcagtggaagaaggagc
tgcttcagtagttgcagtggaggaagatgagcCTCCAGTGGGGGCTGAAGACTgtgctgaagagctggttgtgTCAAGCTCTGAGCCAAAGTATGGACTC
GTTAACTCGTCGGTTTGGTTCGTACTGCTTGGGgcagaagatgctgctgctgctggagctgaggaAGTGGATGGCACAGACTCGGTACCAGGCTTGTGAG
ACTGGGCACTGGGGGATGGTTTAGGTGAATCACCAAAACTAAAGTCGTGGTCGCCGCCCGTTGGCATGGAAGCAAAAGGGTCATCCCCTAAACTTTGTAC
ACCTGTGGGGGTGCCCACACTGAAGGGCAATGCACCGCCACTACCACCGTTAGGTGAATTGCCCATGGGGGTAGAATTGGTCCAGGAGCCGAGAGAACCC
AAGTCCAGCAGGTCTCCGCCAGCGAAATCGAAGCCGAAGGAATCCATCACAGGTTTAAATACTAGCACAAAGACAACAAGACACTATCTAAAGTGGCAAC
AAAACGAAAAGTAAAA