Description :
From Genome Similarity Track
Location :
Scaffold_117:59253- 61256
Sequence
2003 bases(100 bases per row)
CCTCTAGATTGGCTTTCGAGTCTTAAAATAAGACCACAATCTTAATGCCACCCATACAAAACTGAAGAGTCGCCGTATCTAAAAGATTGCATCGAGACTG
AATACAATTTTCACATGCGGGAATGGACTTATAAGACTCGCTTTAGAACTCACCGCTGGAAGTAAGTCGGTCTGCGCGGGTCTCAACTGTAAAATTGTGG
TCTCAAAGACCCTGTTACGTCTTAGGATAAGACCCACCGCAGGAGATACTCTAAGTGCAATTTAAAATAATAGGACGAAGGAAAACATAGTCTCTCCCTT
TAGCCACAAGCGAAACGACTAATTATTCACAGAGCTAGAGGTGTTGATTACCGGACGTACTGCTGCGGTACTAGGGCTTCAGGTAGGCCAGGATATGTAA
ATGACCGCATTTTGTTTTTCAGAAAGCCGTTGCACATACATAGCTTATTTAACTACCTGACAGTAGCCGAAAAAAAGCTAAAATATCACTCAAACCAACG
CTTACTGATTCTCTTATCCACCATGTCATCGTCCATAATAAAATACAACCTGCTCAACATGAATTCAATCAACTGGGCACCGTTAATGGTGATCATGCAG
TAAGGAGATCGCTAACTGAGTAAGATGGAATCTGTACTTCCAGCCGACCGATCAAGTGCACGAATTAAGACCGTTTGATACTGAATAGGAAGGTACAAAA
ATTCATTTGGTTATACTTCGGTAGTGTGACCCGTACGACCCAAGGGCATCTCCTGAGCCTGCTTCGCAGCCGCAGCATCTGCCCAGAAATTGCACCGCTA
TTAGTAAGAAGAAACTGATTTACAACATAACACACGGGAAGTTGGGGATTGTAGCAAGCTAGCCGACCCCGACGATCTTAACGATGTCGATGTCGATGTC
GTCTACGTAGATGGAGCCGCGATTCTCGACGATTCCAGTCGAGTTGAACGGGGTACCGAGCTCCATCAACTTACTGGAGCGCGTTCTCGAGAGACGGCAT
CACCTCACGGCTCCGGAGCTGAAGCTGCCTGCGCACGAGGCCTGAGTCGCATAACCTCTGGGACTTCACTAATGATGCCGGACATAATGGCTAATCATGT
AGCTGACAGTGGCCGATGCTTTCGTCGCAATGCCTAACTAATAAGTCGTCACCGTCGAAGGCGGGATCCCGTCGGCATGTTGTTGGAGCTAAACAAAAAT
CCGATAGATGTCGCTTGAGTGGCAGATAAACTATCTATCACAGGTATATATATGTGGTGGAGCAAGAAGAGAATTTTCCGAAGTCTGAAGCCATCCACCA
AGATCAAGTGTGATCTCCCCCGAGAGTGACACCGACCTCCAGAAGAGTGACCCCCGTCGAAGATGATCTAGACCAGGGGATATCTGCTTGAGAAGGGGTG
ACGTCGATGCCGGGAAAGGAATGATGATCTTGTATCCGGATTACGTCAACGTCCAGCAGAGAGTCGGTGGCGCACCACGAAGGCCGAGGGAACCAGCGAG
CATGCGGTTGGACCACAGGAGCGTGAGAGAACGATGGGACAAGGACTTAGGCAAGGTTAACATTTAAACAGAGTTGATTTTACCCCTTCTTCACAAGTGG
TCTTCGCCTTCGCAGTACCGGGCACGGGATATACTTTGGCCCACCCGACGCTACGCAAGTCGACTTACGCCCCAAGATCAAGGAACCTCGGACGCCAGGA
TAGCTTGGCCCAGCGTCCGTCAACCCTCACTTCGACCCACCGCTAGAGGAAGCGGCAAGCAAGGAAAGGCAAGGAAGGTCACACACCGACCACAAGGCAA
CCCCAGGCCAAGATCACACCTGGCCGGCGAGTGTCGATCTAGACAACCCCAGATCGAAACAGCCACAACTACTCCGGCACAGCGTGAAGCGTATCCGCGT
TGCTGCCACAAGTTCCCGCTGTCCACCAGACAGTCCAAGACTCAACCCCAAGCACGTCTTCTCGAGATCACCCGAAGAGCGATCCAGCCCACCGACGGGT
ACA