Description :
From Genome Similarity Track
Location :
Scaffold_10:592512- 594829
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004568Similar to Cysteine proteinase COT44 (Fragment) (Brassica napus)
Pytul_DAOMBR144PYU1_G004567Similar to KRTAP21-2: Keratin-associated protein 21-2 (Homo sapiens)

Sequence
2317 bases(100 bases per row)
AGACTGGCACCGCCGGTTTCGACGCAGACACCGGACTCCATGGCTGCCGTGGCCGAGAACGCCCAGCACGCGCCGCACTGAGATTGGTCCTTGACAGCCG
TAACGCAACCTTTCTGCTGCCAGTCGACAGTCTCGCCAGAGGCAGCAGCACTAGTCTTCAGGCCGCCGTCCTTGCTTCCACTAGAGGTCGTCGTAGTCGC
ACCAGCTCCAGTCATTGGTGCGGAGCTGTTCGAAGAGCTGCTTGTCGAGTGGGTCGTGTGATGCAGCGGGTTGAGGTCTGGGTTCACGTTGTTGCGGTTG
ACGTACGCCAGGAACTCGTCGTGCGTCATGAGCGCGAACGGCGTGTTGACCGAGAACTTGGCGTACGGGTGCAGCTTCTGGAGCTCTTCGATGTCAGTCA
GCGCCTGGTCAAAGCGCTTCTTCTCCACTGCCGTGACACTCGAATCGCCACTTCCGGTGGCTGTGCCCATGGAGAACTCGCCCGTATTTTGCGAAAAGCT
CGAAGGTGGGAGGAACTTCTTGTTGCACGCTTCCTTGTAGTACTTGGACTGCTTCCACTCGTCGTACGACGCGTGGCGCTCGGCAGTGACAGTCGCAACG
AGCAGCGAGAGGCACACGAGTCTGGACACAGACGCCACCATGTTGCTTTTTTTAGACTGGGGGCTGGTGATTTGGTGGCGTAGGCAGCGCGAGAATTGAA
CAATGAGGAGCATCTTCGCGCATTTCCAAAAGGGATGAACGCCCTCGTGCGCGCATCCGGTGCGTCTCCGTAAAGAGCAGACTCAACAGAGAGCGAGCGA
ACGCGCGCCGTCACGAACCACAGGAGAATGGATACATAGCATTTTCACATAGTAACACGAGCGTCCGTGTAAAAGCAGTGAACACGCAGATGTTGCATGG
CTCTTTGACGGTGGACGCCTTTGCGCTCGGGACCATTTCTGAGTGTTATAGTCAGTTCAGAATGGGTACGGCAAGACCAGATGGCTGGAAGAGTCAGAAT
AAACCTCTTTATATACGGTTTTGCCTTTTTAAAGTGCATACGGGAGCTTTTTTTGTGGGCCACTAGATACTAATACCAGTAACGTCAGATGCCGGATTAC
TGGAGCTCTCGGAGCTGTCGAATCGTGCTCAAGCATCTTCAAGCTACAGAAAAAAGCATCAATTAATTGGATGAAGCTATCGATTACTGATAAAAACAGA
CAATATATACAATAATTACTATTTTAGTAAATTTCCCAAACGGGCGACTCGATTTAACAAATTATCAGACATAATTGAAATTAATCGTTCCCACCCGGTG
ATTCCATGGCGAAGACGATACAAATGTGTGTGCAACTTTTATAATAATGGGCAAAAACAACATCGCTTTCAACATATCGCGCAGCTCGAGCGGTTTAATC
ACTTCTTGCGAAGAGATTTAAGGTGTGCCACCCTTTGGGATACTCGAGTATGTTTGAGCGTCATGTGTGTCGCTAAGCCGCACTGCTTTGACTGCGGCAA
TTGAAGCAAAGACGATGCTGAATTTGCATTATTATTTGGCTGTACCCGCTAACGCATGCAAAGACAAAATGCCCAGATGCCCAGATTGGCAAGCTTGAGC
ACATTATCGATAAGCTTGAACACAAACATAAGATGCTCGCGGAAGGGTTGCTAGTGTGTAATAACCCTTTCACAAGCATTTTGGTATGTATATGCGTACT
ACTCTTTGACCACAATAATGCTGGTGGTTTCTTTTCGTTTCCTCCAGTGAGATTTGCATGGTTTCTCAACAATTGCAGTTTTAGTCGGAGCACTATTTCA
AGAAAACTCTATTTTTTCTAAACAATGTTCTAACTGCAATCAATTATATAATTGTTTGACTTTAACACCGCAACAATGCAAAACAGACAAGAGGGATACG
CCTTGTTCTATAAGAGATACACAAGAAACTGCACAACTACATCGTAACCGCACGCCACTCGAAAAGACTTCTCATCAATATTTGTACATGTTTGTCTGCG
ATTGGAGCGTTTCTAGTAGTCGCACGTCTTCTGCTTCGTCGACGCTGGCTTGGAAACCGCAGGAGTAGCCGCTGGCGCCGGGGACGTCTTGTCTCCGCCA
AGCATTGGAGCCGAGGTTTGCGCAACATTACCTGGGGCAGTTGTTGGCGCAGATGTTGGAGCTTGGGTTGGAGCCACTGGAGCAGAAGTTGGAGTTGCTG
GAGCAGAGGTCGTAGCCACTGGAGCAGAGGTCGTAGCAACTGGAGTAGAGGTCGTGGCCACTGGAGCCGCCGTTGGGGCCGCAGTTGGAGCCGCCGTTGG
GGCCGCAGTTGGAGCCG