Description :
From Genome Similarity Track
Location :
contig_106:59237- 60593
Sequence
1356 bases(100 bases per row)
TCTGGATATGGCAAGTGGATTCTGGGCTGTCCTAATGACCGAGCGAGCCAAGCTGATCTCTGCGTTTGTGTGTCCGTTTGGGCATTTCCAATGGATCCGG
ATGCCGTTCGGCCTAAAGAACGCCCCACTCATTTATCAAGCAGTCATCAACAACTGTCTGTGGGGATTCGTTCGCCTGGATTCTGAGGAAGAAGCAAAGG
TGGACCCTGACGTACTTGATTTCCTGAAACTTGATCCTCTGGAACCCAGGAGTCCTGATAGTACTGAGGAGGATTTCTCGATCTTGACGGATAAGATGAC
AGTCTTCCAGCGTAACATCCCAGCCCCACCTCAGATGGGCCCTGTGCTCGGGCGCAGCTCGTACATTGACGACATCGCTCATGGTGCACCAACATGGGAT
CACCTGTGTGAAGACTTGAACGCTTTACTGTTTCGGTTACGCTATTGGAATATCTCTGTAAGTCTACCCAAGAGCGAATTTGGCAAGTTGTCCATCCCGT
ACCTCTCGCATGAAATTAGTGCTGAAGGTATCCGGGCGAAGCCAAAGATTGCGAAGGGAGTCCAGGATTTGCCGTTCCCGAAGACACTCAAGGGAGTGCA
GTCTTTCATGGGAAGTCTGAATTACTATAATAAGTTTATCGAAGACCTCCCCGTGATCGCCGCTGTCCTATATGAGCTGACGGACGAACAGATACGTGCT
GGACGAGACTTGTCGCGAGCCAAGGAAGCGTTTGAGATCCTGAAGCGCAAGATTGTATCGACTCCACTACTGCGGCATCCTGACCGCACACGACCATTTG
TGATCATCCCGCATGCTAATCAGTGGGCAGCGTCTGCGGTACTAGGCCAAGAGTACGATGGAGTCATTCATCCGGTTCGCTTCACGGGGCGTGTCCTGAA
CGACGCTGAGCTGAGATACCAGCTCGCCGAGAAGGAAGTGATTTCAATCATGCGAGTCCTAGAAGTGTTCAGGAATCTGGTGGAACACAGTCCAAAGATC
GTAGTATACACCCGATACTCTGTGCTTAAGTGGCTACTGACATCCAAGTCGGCAGACGGTAAGAACGTCAAGTGGGGCGTAATCCTGTCACACTGGAATC
TGGAGATCCGCAGAGTGCAACGTGATGAAGACGGACTACCTGCCATCCTAGATGCAGGAATCACACCTAGAGAACACCTGGACGAAGTCGCGGAGAATTT
GATCCCGGCTAAGGGTCGAGTCGCACCAATAATTCCCATTAGTCTGGAGATGTTGGGTGCTGACTTTGAAGGCCACATCCTGAGTTTTGACGGTGCCGCC
AAGACGTCTACACGCCGTGGCAGTTGCGGATGCATTCTGTGGCGCCTCCCTGGATG