Description :
From Genome Similarity Track
Location :
Scaffold_1502:5923- 9083
Transcript NameFunction/comments
Phypl_g13570hypothetical protein
Phypl_g13571hypothetical protein PHYSODRAFT_253596

Sequence
3160 bases(100 bases per row)
TCTGCCACAAGGGCATGCACCGACCGAACGGGGTCGCCAGGGCCCGGGATGTTCACCCGAGACGGCGCAGGAGTGAGCACGCAACGGAAGCCGAGCGCAC
AGACGTTGCACCGGCCCTGGCTGAGGTCACCAGTGTCTAactcgatggagctggtgctggaactggacGACATCCAGGAGGACGCTGCGGCACCGGTCTA
AATGACAACCAACGCAAACGATGAGGACAACGTAGCCGGAGGCAGGTTCTGCTGCGACGCTCGTACCTGGGGAGTACGCGCGTGCACCAGCGGGACGGAT
GTGGTAGAGCGGCCTCCGACGAGAAGCCAGAATGGCGCGGAGTACGCGGGCAGCCGGGGTGACCAAGATCGATGGGAAACGAGCGACGCGTGATCCGCGG
GGAACGTTCCaaagagtgatggtcggcGATCTGAGATCTGGCTCTTTTTTAGAGCGCCCGTCCGGAGATTCGTCCATACGTCGGATCGGGGTGACCCGTC
TATGTGCCCGATCTAGGGACCGAGATCGTAATCCAAGATCCCGATCCAGATCCCGATCCAGGCCCCGATCTAAGGTTTACGTCAACATGGGACGTGCAAG
CACGACAGGCCGATTGGTACACAATGGGAGGCTGCTAGAGCTTCAAGTAGGCAGCTGATAGGGAAGGATAGGATAGGGTAAGGCGACCAGTCCCGAATAT
TCTTTGAGATACGCAAGTGGGAATCCcttcgtgctcaagaaccttCCAGCGTCGGCAAGCAGAGCTGCCACGATAACGCGGCCCCCCGGCGCTAGTTGGA
TCGGAGACTCAACCCCACAANACGAAGACCCGCGCTGGCCCGATAACGCCGTGCAACcgaggagagagagagagagagagagagaggacGCCACCGCGTA
CGAACGGGATGTCGAAGCAAGAGAGACGCAGGGTGAGGACCACCCGCGCTGCGTCgaagcagctcttcgaggTTCGAGCGACAACACCGCTGGAGCTTCA
CTTCACCCAGAGATACGCTACTCAAGAACCGGGGAAATACCCGACGGNGACGGGTTTGTGCGAGGACGACTTGGCGGATTTACGCGAGGGCACTACTCCA
CAGTACTGCTTCTCTTTCCGGCTTCACTGTCGCTGTCTTTTGGGTTCAACCCTCCGGCCCCGCCCAGAAAATCACCAAGAGAATCGAATTCACGAACTTG
CAAAAGTTCTCGCAGTTTGGTCGATTTCAGCCCCTCCTTGAACAGGATCATTTTATACTGCTCAGAGACATCATCCGTGTTGCCCAGGCGTACAAACTCC
TCAATGTATGTATCCAGCGACTTCGCACCCTACCTACAAtcgagaaaaaaaactggCGACGAGATATTCCTCTTTAGCCTTGGTACCAAACCGATTACGC
ATCCCTTTAATCATCGCAGTCCAGGTTCGGGATCCTTTGTAGTCCTGAAGCAATCAGTGCTTTGCCTTGGGTTCATCATCAGTTGTCCCACACGAGAGTC
GACCGGGGAATTTTTGAAGTATAGCCCGTACGCCGCGTACCAAGTAATCATGTTGAGAGCGTATACCTCGACGTCTTTAGAGTCTTCTCCGCTGTAAATC
AGCGTTTCTTTTTGCTTGATGCACTTCTCCACTTGCTTCTCCAAATCTGTCTTAGAGAGCGCGTTCACAGCATGATCCGGAATTGGTCCCGTGACGTCCC
ATTCTGGGTAGAGGTCGTCGGCTGCAAACACCAGTGACCCCGGTTCAATTTTATTCACGGTGTCCTAGAGGGTGTTGATGTTTTCGATGAGGCTTATTTC
GATTCATATCTCTGTTGCTTGGGTTGTGGCCATGCTGATCTGAGTTTCTAATGCGCTCAGTTTCGTGTTCACTTGTTGCGAAGTAGCTTGACCCTGCGTG
ACGAaacgctgaagcagcagttgaTTCTCTTTGAGGATCTGGGCACTGGCGAGATGTTTCTCGTCGCTTTTCAGCGCGTATTCATCCATCCCTTTCGTGA
TACCCAGTTGATCAACGCTTACTTTCTGAAGTTGGGTCTGGAAACCTTGAAAGTCAGCCAGGACTCCTCGAAGTTCAATTACTTCTTCAACCGTCAGCGG
TTGTACCAACTCGTTTGTACACGAGGCTTCTCCCATGTTACTGTGACTCATTTTCTTGCTGTAGCTCCTGGACGAATGCTACTATGTTGCAATATGGTGC
CACCTACTCCTGAAGTGGACTTCACTTGTAGTGGCAACCACGTCTtcggcgatgaggaagctgaGTCAGAAGCAGGAGCGAAGCAAGGAACGAGGATAGT
GTTTGCTCTAGATGAGTTTTATTAGAGTGATGAAGAGGCAAGCACGGCGGCAGATCTAAACCTACCGTCGCTACGGCTGTTCTGAAACCACCGTCACTGC
TTGCTAGTTATAGAGTTGTGTAAATGTGCATTTTGCCGCTATCTCTTACCTGGCTCGTCGCTGGTATCTCCAAATCTGCTTCGCCACCATCTTGATTTGG
ATtccttctccgtcggcgTCTGGTTCGAGtccgtcgacagcaacacTTTCACCCGGAACACCGACACTACCTCGTGtggacgctgccgctggagatCTCG
TACTATTTCATCTTACCGGCGTTCGTCCTGGCGGTGCTGAAATTGGGTCGGTTCTGGTGGATGTCGTTCGTGCCGCTGTACGTCTGGGTGATCCACGAGG
GACTGTACACGACTCGAAACAACTTCTACCGCCAGCCTCTGAGCATGCACCTGCCGACGTTCGTCGCGGGCTcgatggccgccgccatcttcgtgaagct
ggacgcgTGGATCAAAGCCATGGGATTCAAGATCCGCacgctgcacgtcgtcgccctccgGGTCGTCGAGACCGCCTTGATCGCAGCTTATCTCAGCGTG
GTCTTCCGAGGACTTTTCTTCAACTGGCTGGGAAtgccgctgccgcctgcAACCAGATACATTATGCCGTTCACAAGTGTCAAGCTTTCTCTGTTGATTG
TCATTGAGATGCTCCAGCCCTCGACACTGTCGCTCATCTTTGAGTGGATTGTGCTCAGGTACTTGGGCAAGATCAGCTTCTCGGTGTACCTGTTGCACGT
GTTCGTGATCTACACGCCACCTATCAAGGAGGGAATGAACTACTACGACAAGACTTTCGC