Description :
From Genome Similarity Track
Location :
contig_8:592134- 593612
Transcript NameFunction/comments
g1655.t1hypothetical protein

Sequence
1478 bases(100 bases per row)
TCAGCATAGCAATCTCGTTAAACAATCGACTGCGCTCATCCTTCAACATGTTGGTCGTCGTCTTGAAAGCCTCAAATTCGATAGTCTTTTCCTCCAGCTT
ACCCCGACTTCGCTCCAGTTTCGACTTGGTCTTCGCAAATTCATCGGCCAGCTTTTCTCGCTCTTCCTCGACCGACCGCAACTGCTCTTCGATTGTAGCA
ATCAAAGCTACTTTCTGCTCTAGCTGCTGCTCCAGCTCTGCGATCTTGTCGTCCGCAATAGAAAGCCGATCTTCAAGCTCTGCCTTAGCCTGCATACGCT
CTTGCAGCGTGGACTCAAGTCCTTGTTTCGCCTCGTAGGCAACTTGAAGCTTCTGTTCCATCTCGATCATCTCAATCAAAGCTGCTTCGAATTCCCGACG
TTCTGCGTCAAGAGAGGCGCTATTAACCGCGCACGCTGGGCCGCTCGACCTTGATACCTCCACCAATTTCTTCTCAAGAGCTGTGAGCTGCTGCTTCTGA
TCCAAGAAATTGACCTTAGCTTGGACTAATGAAGAGCGCAATTCCTCGACCTCACGATCTTTCTCCTGCCACTCGTCCGGCTCAGTCTTGCTGTCTACCA
CAGCATTCAGCTCACTAATTCTCTCTTCCAGAACGTCGTTTTCGGTCTTGATATCATCCAAATCCCGCTTAATCTTGCAGTTTTCCTTTTCAGCCTTGAC
TACAATGCTATTCAGGTCAGCAATAACAGAATGAAAATCTTCCTTTTGCATAGCAAAAGCCTCAAGTTGACATCGCAGATCCTCGGATGTACTCTTGAGA
TTCGACTCGAGCGTTTGGTTGTCCGATTTCAGAGGTCCAAGCTGTGCAAAAATTGCGTCTAGCTCGGACGTTTGCTCGCGGTGCGTCTCCAGTAACGTTT
CGTGATCTTGTTTGAGTTTCGATACACCATCCGCCGTCTTCGCTACCTCAAAAATCATGCGCAGATTTTCAGCTTTGCACGCGGCCATTTCTGCCTCGAC
AGCATGTAGTTGAGCCTTTGTGGCTTCCAACTCACGTTCGAGGTTAGAGTCTCCATTGCAGCTCTCGGCTGTTTCACCATTCGATGACCGAGGCAGCATC
CTCCCCTGATGATGTGTACTTGTTGGTGTCAGAGCAATCGTCGAGGCCTCTAACAGCCAGTTTTTCAATCTCCGAGGCACGCTCCTTTAGAGCAATTTCG
CAATCTTCCAGCCTAGAAACAAGCTGTTGGTTCTCCGCCTCGTATCTGTGTATCCTTTCCTGGAGAATGTCTGCTTCGCTTTGACGGTGCTCCATTTCTG
GCTTCGCCACACCAGCGAGTTGCTCCTGGATATGGTCCAGATAAAACTCGAGTTCTGCTAATCGGGAGCTACGACTGACATCACCATCAACCTCGGTGGG
TATAGGTTTGGTTAATCGTAATGCAGCAGCAAATGCCTCAAGTTTGTTCTTGATCGCAGAGAAATCGTCGAGTAGCTG