Description :
From Genome Similarity Track
Location :
Scaffold_818:5921- 7021
Transcript NameFunction/comments
Phymu_g12065hypothetical protein

Sequence
1100 bases(100 bases per row)
GTTGCTCAGCACCTTCGATACCGTCTTGTCCTGTGTGGTAGTGTTGAATACATAAGCAAAAGCTTTGTTTGTAGCAGTCATGCTCCAATTACCGCGATCG
AAGATCCATTGAGCGCTTAACGACGAGTCTCCATTTGCATGCTGAGCACCCCCACGGCGAAATGAATGCGACGATAAATTGGCCGTGATGTTTGCCTTCG
TCTGATTAGCAGCTGCACCTTTCCGAACCCGATTAACGTAGCCTTGGAGCTTCAGCGGAGCCGCGAGAATCTGTCGCGCACTCGCTGATGCAACTGCACG
ATCGCTAACTTCGGAACAGCGAAGTAGCACGTCCCTCAGTGGGGTCTGACTCAAGGAAACAGGCAAGTCAGTCTCGGTGTCGTTTGACAGCAGCGCTAGG
TTAAGTAGCGACGGAATTGGAAATGTCTGTATGGCTAATGCCATCGCAATAGCGTTAATCGGGCAGGTAacgaacgagttcttctctGGGAAAAGAGAAA
GACCTTGTTCTTCGGATGTTTTTGCTCTTATCAAACGAATGAAGATAACTCTACCCGCCGACAAGGAAAGAATCGACTTTGGAATGTATGTGAGGTCCGA
CGCTCTCCCAAATGCGTACCACATGACCACCAAAAGAGCCACATCTTGGTACTCCGTTTCTCTACTACATCGTAGTACAGACCATCCACAAGGGAACGTA
AGTCGTCTTTCGTGCATACAGGAGCTTTGTTGACCAAACCTCCCTTCTGACGTAGAAGGTAGTGGCGCTCCAAAATTCTCCCCATCTTAAGTAGTTGCTG
TTCAGTGACAGCACAGTGTTGAGGGTAGCGATCGAGCAGCCCGTTTTTCACGTTGCGTAGTAACTCATCACCGTATTCCGCTTCCGAGGCTCGCCACCCT
TCCCATTCGAGGATGCTAGAAACATTGCAAAGCGATCGATCAGCTTCACAAAAGCTTCCCCGCGGCTGTCGACCAGAAGACAGGCTTGAACAAACTCCCT
CGTCACATTTTCCTAGGAAAGGAATTGGTCGAAGGTGCTTATCGCTGTTGCTAGTGCGCGCTTCGTGTTCTCAGGGGCAAGATCTTGGAGACTCATGTTG