Description :
From Genome Similarity Track
Location :
Scaffold_152:59209- 60212
Transcript NameFunction/comments
g6771.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GGAGTCGATCAAAGAGTATGTGACGCGATTTGCCCCACAGTGGGGAGCACATGATCTAGGAGACATGGATGAAGATATTAGCGAGATCGAGGTGCAGGCT
GCGATAATGAAGTGCAAGGTCGGCAAAGCATGTGGACCGGATGACTTGGGGAATGCGTGGTATCGAGATAACATCGATCTCTTGGTGCCAATCCTAACCA
AAGTGCTCAACGACTGTCTGGAAAACGGGACCACCCCAGTGAGCTTCTTGGAGGCTTACATATCCAGCATTTCCAAAGGAGGCGATAAAGCAGACCCATT
AAACTATAGGCCGATTGCTCTATTGAATACGGACTACAAGATTTTCACACGAATCATGGCGTGGAGGGTGCGGAGGCACATATTGACGCTGGTGCACACC
ACCCAGTTTAGCTTCATCCCCGGCAGGACGATCCACGAAGCAATAGATCTGTTCGAAGCAGCAAAGGAGACTTGTGCCAACGAGGGGCAACTCAACGACG
CGCAGGTCTTACTACTGGACTTCGCCAAGGCGTATGACTCGCTGGACCGCGACTTCCTGTTCGCGGTGCTGGCGGCGAAGGGGTTCCCGCCTAAGTTCTA
CCGAATGGTGAGGGCGATACATACCAATACAACGGTGCGCTTCATGGCTAACGGTGCCTTGTCGAGGGCAGTGCGGGTCACGAGTGGCATTCGGCAGGGT
TGCCCACTAGCGCCTCTCCTCTTCATATTGGCCGTGGATCTCTTGTATGATGAAGTACTGAGTGTGCCGCAGATAAGTGGAGTGCCCCTCAAAAGCAAGG
TCACAGATGACGGCAGAATGCAGAAGGTAGAAGAGCTCCGGGTGGCGGGTTACGCTGACGATACAGCAATCTACGTTGGAAACAGGAGCATGCAGATGGC
AGCCATAGCAGCAGTGGGCCGTTTCTCTGCGGTTTCCGGCTTGCTGCTGAACGTAAGCAAATCGGCAGCTATTCGACTCAGTGGAACGATCGAGATAGAG
ACA