Description :
From Genome Similarity Track
Location :
Scaffold_14:592045- 594144
Sequence
2099 bases(100 bases per row)
CCATGCTCCAGCACTCGATCCCGGTAGTCCGCAGACTTTTCGCCAAGCACGAAGCCGTCTTCAAGAAACAGCTTCATGAACGCAACCAGCAGCTTTGATT
TCGACCGCTGCTGGTTTGGTTCTCATACCAGCGTGGCTCTTGCGCATACCAGGTAAACCAAATTGCATGAAGGTGCGTAGCAGATCCTCTGCGCTGTTTC
TTCTTGGGCTCGCTCACATCCGCTGTGTCTTCATCTTGTCTGTTCCTTTTGTGCGTTGCAGCTACAGGATCCCCGTTTATCGGTGCCTCTAGAATGTCCA
TGTGGGCATCTTGGCGTTTGGAATTCTTGATAAGGTGTTTAATGACAGCGGCTTGGTTCTCGATGATCTTCTGTTCTTGGCTTGGCTCTGTTGAGTTGGA
TTCGTGCTTGCGTGGTGGTGTGGCGGGTTCATCACTTTCTTTACAGGGGCTCCGAGCTTTGGCAAGATGGGCTGACCAGACAAGGAAATCCGCAAGCGTA
CGCCCAGCATGTGCAACACAGGTTTCGAATCGATTCACCACACTACTTTTAGGATTCAAGTCCTTCAACACAGGATAGTACCGAACGAGGCAGGCGGTAA
GACAGTCCAAAACCTTTCGGTTGATGTTGAAGGTCTCTGTCTGAAGCTGGTAGCAAGCTGCGAACAGTACCCGTTGGAACCGGGCGATCGAGTCAAGCGT
GTCGGCGTCGAAGCTGGACAGGTCTTGGAGATGGACAGCGGCTGACGGTTTGTATCCGCTCAATATCTTGGCAATCATGTGATCTTCTCTACTCCTGTCC
AATATGTAGTTGAATCCCTTGTTTGGGATGCTTAGATTCCAAGATCCTCGGTCAAAGATCCAGCGCGCAGTCATTTTCTCGCAGCCGTTGGCATGCTGTG
CCCCACCGCGGCGGAAGGAGTGCGACGTTAGCGCAGCCGACACACCAGCGCCGAGGCAGACGCGACCAAGCACACGGTTAACATGCGCGTAAACCGTCGG
TGCCGTGCCAGCACGAGGTGGTGGAGGCACAGGCGTCGAAAGACCAGAGGTCGACGGCGGTGCGTTGAGAAGCTCCACGAGCGGAACATCCGGAGAGAGC
GAGATCGGTGTTTGGAGGACTTGGTCGGGCAGGTTGTCGATGAGAGCTGGGGACGGTGCGGCTTGGACGGAGAGGGCAAGCGCGACAGCGAGCAAGGGAC
ACGTAGAAAAGTCGGCGTCCGGGAAGAGCGACAGGCCTTGCTCTTCCGATATCTTGACACGGACCAAGCGTAGAAAGAAGACGTCCGCAGCATCAATGGA
GATATTCCGCTTCTTGATCATCGACAGGTCGGAAGCTCTCCCGAACAGGTACCAGAGAAGACATAGAAGAATAGCATCTTGGTAATCACTCTCAGAACAT
GAATTAGTATACAACATGCCATCATTTTTTTCAAGTCAGCCTTCGTACATGGTGGAGCTTTTGTTACGAAGCCACCACCATCTCTTTTCAAACAAAAGCT
ATCTAGGGTTTTCCCCATTTTTAACAGCCGCGATTCCAGTGACGCTCGGTGCTGAGGAAATTGCTCTAGGAGCCAAATCTATGCTTGGCGATAGTACTGC
ATTGCAGTGTTTCGTGCCTGCAGTTTGCCCTTCTTTCCTTCGCTAAACGCAAGATACATTCCAAACTTATCCATGACACACAAAGCTCTTGCCACTTTCA
TCTGCCTCAATACATTTTCTTACAAATTACCCTTCAACTTCCTCACCCTTCAAAAACTTGGAGAATGCTGCGACAGCAGTTGCCTTGGCACGCAATGTGT
TACCGGGCTGCAGCTCCTCCAAACCCATCGTGATGGTCCGATAAAGAGAAATATGAAAGTGATATGCCTAACACTTGACAATTGAATGAATACACACATA
TTTTAGAAGTTCATCGGACCTGATACGCCCGATTGGGTGGTTTAGTTGACTCACCTACACCTACAGTGTCCTATTGGCTAAATATACAATTTTTATTAGC
TGTGATTGGATAAAATTAAATTATGGTTGTTAATTGACAAATTTTCACCATACAAAGTTCAAGTATGGTCCGATAATCTAACATATTCATCCACATCAT