Description :
From Genome Similarity Track
Location :
contig_124:59202- 66521
Transcript NameFunction/comments
g14033.t1hypothetical protein
g14034.t1hypothetical protein
g14035.t1ETK82234.1 hypothetical protein L915_12345 [Phytophthora parasitica
g14036.t1POM74146.1 Serine hydroxymethyltransferase, mitochondrial precursor [Phytophthora palmivora var. palmivora

Sequence
7319 bases(100 bases per row)
CGAGAAATTCTTTAAACTGGTGAAGATGGGTATGCCTGCCGAGCAAGTAAAAATGAAGATGATCGCCGCGGGCTTGAATGCGGACTTGTTGGACACGCCA
GATGCGCCGTCACCCAACCAGAAGTCAGCTGGCAGTAGTGCTGGCGGCGGTCTTCTTTCAGGACTCCCTCCTCCAACGGAAGCGGTGAAGGTGGACCCAT
CGGCTTTGAAAGCAAGTTTAGCCTCAAAATTAAACAACAAAGCAGCACCCAAGAAGCCCGAGGAGCCTCAGCTGCCGAAGAAGGAAACCGTGAAGCCGAA
TGTTGAATTGCGCCCGCTGTTCTGGACCCGCGTGCCTGTAAATGTAGTTAGCAGCACTGTGTGGATGAAACTGAACGACTCGCATGCCGAGATGGACGTG
GACGAGATGGAGTGGATGTTCCGTAAAAACCCGGTGGACGCGTCGAAAAAGATTGATGAAAAGAAGAAAGAAGCGGAGAAGGTACTGGCACAGCCCAAGG
AAGTACTTTTGTTTGACCCGAAGAGACAGCAAAATGTGTCCATCGCCATTGCTCGGTTTAAGATGTCATCAGAGGATATCAAGAACGCAATTTATGCTTT
GGACGGGCAGAAACTGGGGTCTGAAGTGCTGAACGTGCTCATTTCTATCTCTCCTACGCTGGAAGAGATTGACATGCTCAAGAATTACGATGGAGATGTA
AAGCTGCTAGGAAATGTTGAGAAGTTCTTCCTTGATTGCTGACCATTCCGCGCTATACTCAGCGTATCAAGTGCTTCAGGTACAAGTTACAGTTCGAGAA
TCGCATCCTCGAAACCCAGGCACAGCTGGATACATTGGTTGCTGCTACGGACCAAGTGGCTGAAAGTGACAAGTTCCGCCGCGTTCTGGAGCACATTTTG
GCGATCGGCAACTATTTGAATGGTAGCACTCCTCGTGGTGGCGCGTATGGCTTTAAGCTGGACACTCTTATGAAACTGCACACGCTGAAGTCGGTTGATC
CTCGTGTTACCTTAATGCACTTCCTGTTGCGTCAGCTGGAAGAGAAGTCTCCTGATGTCATACTTTCGCTGGAGAAGTTCCCCATATTGTGGAAGCGAAG
AGACTGTCTCTTGATCAACTACGCGCCGATCTGTCGTCCTACAACACCGCTAGCTATGCTGAAGGGCCAAGTGCGTGCGTCCAAGAATGATCACATTGAG
GGTGACAAGTTTTACGAGGTGATGACTCCGTTTGCAAAGGATGCAGAAGAGGTACTGGAAGAGCTGGGACGCGATTTTAACGGCTTGGAAACTTGCTATC
AAGAGCTTGTCAGCTCCTTTGGTGAAGATCCACGAAAAGTTGGGCCCATGGAATTCTTTAATATCCTGGATGAGTTTGTGACGGAGTTCAAGAAGGCTTA
CCGTCAAAATCAGACGAAGGAATATCAAACTATCTATGAGGAGGCTGCAGCGGCGCGTGCTGCTGCTGTGGCTGAGAAGGCTGAGCGATTAAAGCACGAG
GCCGAAGAACGCCAGCGGCTGGAAGAAGAACGGCAGCAAAACTCGCAGGAGACCAAGGCGATTTATGCCGAAATTATGTCCATCATCACCGCCTGGGCTG
GGAAGCATTCGCCAGGTAACGAAGACGCAGTGATCGAGCAGTTTAAGGAATCATCGCGGAAGTTTGGCTTGGATGAGATCACAGCTGATGAGTTTTGTGA
CCAAGTGCGCCAGTGCGTTGGGTCGAAAACGGCAGGTAAAATTATTCCAAACAGTGCGAAGCTTCTGTCCGACGAAGAGAAGCAGAGTGTGCTGCTAGAG
GCGTTTGCTCGATTCAAGGGGCAAGTGAAGAAAGAGAAGGAGTCGAAGAAACAACAACGCAATTCATTGGTGTCCCCACCGTCCGAAGGGCGCGAGAGGG
CGGGGTCCTCATCGGCGGGTCGCAGACGCAACAAGGTCACGGTCCCGCTTCCGATAAAGGACATCGAGCCTGTGGTCGGAGAAGAGGCCCAGCTGCTTCA
CAAGTCCATCTTGGAATCTGTGCTGGCGGCGTTTGGTGGCGATCCAAAGAAAATGAAGTCGTTCACGTCCCATACTCGCAAGTATGGCAACGAGCAGATC
ACGGCGCACGAGTTCTACCAGTATTTAATGGAATCGTTCGATCCTGACTTTGTTGGACGCCTGGTGCCCGACCTCGCGCGTCTGCTGCAGGATTCGGAGA
AACGCCACGCACTCATTCGAGCATTGTGTGAAAGTGCGCCGGGCTGGGCAAAGTTCGCGGGCCTATAGAATGGCAGCTTCCTGAGGGTTGAGCGAGAAGG
TTGTTCTATCCAGGATTTTGCGAGGCCAGTATGAAAGTGGCTCAATTTATAATGAAGATTACAGAAGTCGTTGCGCATTACAGCGGCTAAATTTTAGCTT
GCTGGGGTCGATGCAACGAGCGGTATTGGAAAGTTTCTTTGATGCTAGTGCTAAGCGCGAAGGCTGTTGGAGCTGCTCTGTTGCGAGAGCGGGAAATCGC
TGTAGTGCTTAGGCTTGCGCACCGCAGGGTCGGGCAGTGCGCTGCCTTTTTCCTGTTTGGCGCGCCATAGATCCTGCTGGTCCTTGAGACCACGCACCCA
CCGCTTCATGTCGCCTTTGCTCTCGGCGCGCAGGAAGAAGCTGCGCTCGGGGGTCTTGACGACGAAGCTGTACACGCCGTGGTCGCCGTTCTCGAACCGC
CGGATAGACTCGATGCCAAGGAGGTCGATGACCTTAGATGCTTCTTGCGAGCTTTCGTGCTGGTAGTACTTGAGCCTCATGCCCTCGAGGGCGAAGAAGC
GCTTGTTCCATTGCGGGGTCAACAGCCGCTCCTTGGCCTTCATCTTGAACAGGTAGCCGCTGATGGGAACGGGGCCGCGTTCAGCTGGGGTCTTCATGTT
CGCCGTGACTTCGTCGTCGACTGGGCAGATGCCGCTTACAGAGCGGGTGGCGAAGTGAAAAGTGCTCGGGGGTCAGTGTGCAGGCTATTGCTGGCAGCAA
ATTGCTGGCTTGGGCATCTTGTCGCGATGTTGAAGTTCTTTTTTTAGAATCGATTGTTTTAGAATCGCTAACACAAGTTCTATTTTTAGAATGTACACAA
GCTTGACATAATTTATGTGGCACTTGTGTTGAGATACGCCCGTCGTGGATGCCGCTGACGTCGATGCCAGCGTTGCTGCATATCCTGGCACTGCTCGCTA
CTCTGCTGTGTCTGGCCTCCTCCCCGGTCATGGCATCAACTGCTCAACAGCTGACGCTGCGCGTGGAATTGCAGCAGCAGCTCGGACTGCCGGAGACGCT
GCAGGCTCCGATGACCCTCAGGCTGACAAACGCTCCGGCCTCATTGACAGAGCTGCAAAGTGAGCTCCGTCAGCGGTTAACAGAACGTCTTATGGAGAAT
AAAAACAGCGAGCGAGTAGCTGCTGAATTGGAGATGGCGATCGAAGTATATGACCAGAAGATGCAGCAGTTTGTGCCTTCAAAGAGCTCCAACAGCTCGG
ACGTCGCTCGAGACTGAGCGTCACGTTCACCAACGCAGATGACCTGTTCCCGGACCATACGTGCCTAGCACTGCCGTCAAGGATCTTTGGGTTTGATGCA
GCGGAAGGCGGCAAGTTTGCGATCGACGGGAGGGTGGTGCATATTGAGGAGGTGGGCAACTCCGGCAAGGGCACGGGATTGACGACGTGGGACGGATCCG
TGGTGCTGGCGAAGTATATCGAGCACCAACGACGTGATGATGTCGCTGGGAGCCGAATTGTGGAGCTGGGCGCCGGGACAGGACTAGTAGGCATCTCTGC
TGCGCTGCTCGGAGCACGACAAGTGATCCTGACGGACCTCGACTACGTCGTGGACAACCTCGCCAAGAACGTGGCTGAGACGATGAAACTTGCAGCTAGT
GAAGGCAAACCCGTAGAGAGCGACGTGTCAACGCAAGTGCTCAACTGGTTCGACCCGCCAACGGATTTGGGAGACATCGACTTTTTGCTGGCGTCGGACG
TCGTGTGGGTCGAGGAGCTCATTCCGCCGCTCGTCGCGACGTTCGACGTGTTGCTGCGCCATTCCGCCGTGCAGACGCGAATCCTCATGTCATACCAGAA
GCGCAGCATCATGTCGGACCGACTGCTCTTCAGCGAGCTCGAGCGTCACAGCCTCGTCAAAACCCGCGTTCCAGCCGCAGCCTTACATCCGGAGTTTTCC
ACCGACCGGATCGACGTGTGGGAGATTGAGTGGGGCGCAGCAGAGCGAAGCAACTAGAACGCCGTGGTCGAATAGAGGAACGTGCGGTGCGCGCCCAAAT
AACAAAGCCGATGCTGCTTCAACTGGAGGCAACGTAATCTGCATAGCGACGCTGGGCATCCTATCAATGTCGACTGACAAGCAGCGCGTGGTCAAGTTCA
AATCCTACGATAGCACGAGCCCTTGAAAATGTATTTACTTGGGAAATTAATTCTCCACATCTACATTCTCACTTCGTTCGACCTTGCACATTACATATTA
CTGTGAGACATAAACATAGTTAAAGGCCAAAGTTTTCGTGGTGTCTGCTGCAACCGATCTTGGCGCCCGTCGGACGCTGTGCGAGCCATTCGCGTACTTG
CCCCGTTCCAGCCACAAGATGCTCGGCTTCCTGCGTGCTCCCGCCCGTCGCGCGGCGCTCCTGGCGCGCCGCCACTCCTCCTCCGAGAGCCTGCAGTGGG
CCGCCGCCATGAACAAGCCGCTGGCCGAGTCGGACCCGGAGCTGTTCAACATCATCGAGCTCGAGAAGCAGCGCCAGCGCGACTGCATCAGCCTCATCGC
GTCCGAGAACTGCACGTCCGTGGCGGTGCTGGACGCGCTGGGCTCCGTCATGTCTAACAAGTACTCGGAGGGCTACCCGGGCGCGCGCTACTACGGCGGC
AACCAGATCATCGACCAGGCTGAGGAGCTCTGCCGCGCGCGCGCCCTCGAGGCCTTCAACCTCGACCCGGAGCAGTGGGGAGTCAACGTGCAGTCGCTGT
CTGGCTCACCCGCCAACTTCCAGGTGTACACGGCGCTGCTGGCGCCGCACGACCGCATCATGGCGCTGGACCTGCCCCACGGCGGCCACCTGTCGCACGG
CTACCAACTCGGCCGCAAGAAGATCTCGGCTACGTCTATCTTCTTCGAGAGCATGCCCTACCGCCTGGACGAGAGCACGGGCCTTATTGACTACGACGGA
CTCGAGAAGACCGCCGGCCTGTTCCGTCCCAAGCTCATTGTGGCCGGTACCAGCGCGTACTCGCGCCACATTGACTACGCGCGGATGCGCGAGATCTGTG
ACCAGCAGGACGCCGTGATGCTCGCTGACATGGCTCACATCAGTGGCTTGGTGGCTGCTGGCGTCGTGCCCTCGCCGTTTGAGTACGCGGATGTGGTGAC
CACCACCACGCACAAGTCGCTGCGTGGACCTCGTGGAGCCATGATCTTCTACCGCAAGGGCGTGCACCACGTGGACAAGAAGAGCGGCAAAGAGGTTTTG
TACGACCTTCAGCAGAAGATCGACTTTGCCGTGTTCCCCGGACTCCAGGGCGGACCCCACAACCACACGATCGCAGCGCTGAGCACGGCGCTGCTGCAGG
CGCAGAGCCCGGAGTTCAAGGCGTACCAGTCGCAGGTGATCGCCAACTCCCGGGCCATGGTGGGTGAGCTGATGAAGCGCGGCTACGAGGTGGTCTCGAA
CGGCACGGACAACCACCTGGCCCTGGTGGATGTGAAGAAGTCGCGTGGCGTGGATGGCGCCCGCGTTGAGTTTGTGCTCGAGAGCGCCAACATGGTGGTG
AACAAGAACACAGTGCCCGGCGACAAGAGCGCCTTTGTGCCCGGTGGCATTCGCCTTGGTGCCCCTGCGCTGACAACGCGTGGCTGCACGGAGGAGGACT
TCGAACAGGTGGCCGCCTTCATTGACAGCGGTGTGAAGCTCACGGCTGAGCTGAACGAGCGTGCCCGTGGACAAGGAGTGAAGAAGGTGAAGGACTTTAA
GGCGTTTGTCGCTGATGACGTCGAGGCGAAAGATAGGGTGGATGCACTGAAGGCCGACGTGACGGCGTTTGTGCGCCAGTTCCCGACGATCGGCTTCAGC
GAAGAGGGCATGAAGTACAAGGACTAAAGTGTCCGACAGGCAAAGAAGAGGTTTCGTTGCTGAGTGTATGAATGGCATGACGACCTAGTCTATCCGATAC
TGGCTCGGTCCGTCTCCTCTTTGCCCCGAGACTCTCTGCAAGGATGACCAAGAGGGCGATACAAGAAGACGTGGCTGCTTCTGCTCCCTGACATTGCCAT
GGAAGGCAGCATGATGGTCTCCTCTTGACCCGTTCTGACGGCACGGAGCTCGCGGCGGCGTGAAGACAGATTGAAATGGAAGTTACGACATTGAACAATG
AACGACCTGCCTGCCTGTAGTAGACTCAGCTCACACTGATACTTTGCTGCCTCAGTGAGACCCGCTGCACCCATATGAGAGGAAGCACTGAGGGGTTCAC
TCTAATTGTTAGTGCTCCTTGGCTTGATTCATGCAGGAACTTGAGGAGCAAACATGTATGGTAACGGATGGAGTGTGCTGCGTTGCTTTTGACGCCAAGT
GTAGCCATTTCCGATAGCTCCCCTGCCAAACCCGATCTCGAGTGACGATCGTGTCGCAGGCACGCAAAAAATCTCACTGGACTGGCAGTTGACTTGCAGC
CAGTATGCCCGGGCTGATGCATGAGGAGCGCCAGGTGGCGGCGGCCGGAATTGCGTGCGGCTCCAAGCTAGGAGCACCGCTCCGAGCAGGCAGTGACAGG
CCCGCCATTTGGCGCGGTGTCGCCCACGACTGAGGAAAGTGCTCGATAGCGTGCGAGCGACCACAGCCCCCTTTAAGCCGTCCATCCCGATTTAGTCGGT
GCGTACGAAACAGAATTGTAGCGGCTAGCTCTTCAGCCGCACCTTTTATTATGGACCGGCACGTACCGTTCCTCTCGGATAAAGTTTCCATCCTGTCGTA
GGTGACAGATGGCATTCGACGTTCAGTATCGAAGGTTGTACAGTGGCATGACCGTATAAACTTAAGCGGCATTCTGACTAGCTACTGTCTCTTTTTTTCC
AGTATGCATTTTTGGGCTCTTTTGCATTTTTTGGGCACTGGTGAGACCCGATGATCTTCGCGCTCCGAGCAGCCATACGCAAGTCTCGCTAATGCATGCA
CCCTGCAGCACTGCCTGCACTGGCAACAGCAACATTGGCAGCAGCATCATCGTGTTGTCGCGTCGAATTGCTGCCTTTCGAACCGATTCAGCGCTTCCCA
CGCCAAATTTATTTAGCTC