Description :
From Genome Similarity Track
Location :
Scaffold_24:5920- 7005
Sequence
1085 bases(100 bases per row)
CTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTT
AAGTATACTTGTTGATACAAGTATACTGAACTCAAGTAATTTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAG
CAGACCCATTACAGCGTCTAAAGCTACAGATGCGGTGGCGAGCAAGCGTCACAATAATGACAGGTTCATGCACCACGGCGCCAGCTCCTACAACGACCAT
GCAGTCGATCGAGACGCCGACAAACAAGGCGTCCATTGTGGCGACTGAGAGGTCAACGTCTACAACTGCTGCGAGAACTACGACTCCTGGTGCGCTGACG
GTGGGCCCTACAGCGACAGCGACGCCTACAGTTGCGGTGATGAGTTCGACTGCCGCATCGTGCGCCTCTACGACGTCTTCTGCCCTGGACCCGTCGGCGC
CTCATTCCGTATACGTCACAGCGGTACAATGAGCGCCAATACCACGGGCACAACGGTAAATATTTATTCTTTATCTGCCTCACCGAGTTTATGCCACCCT
CTATCTTGATGTTGTTGCTTTGTCTATAATATACCTAGTGCGAAGAAATGAATGTTGAGTTCGACCCCAGTTTTTCTTGTTGATTCTTCTTATTCGGTGA
TACTGCTAATGATGATAAGCTGTGATGCTTGATTGACCCCATTCCTCGTTAGTATATTGTGCAATGTATTGGTCAACTCTACGCAGGTTTCGGGCGAATG
AAAACTGGCAAGGCAGAAGGCGGCGTAGGGTCAACAACATCGCCACGCTCAACTCGACCGTGGAGCTGTGTGATGTGGCCGTCAAGTCTTCCCAGGTTTT
GCATGTGTCGAAGTGACTTCAATGCTGTGCTTACTGCGACGGCTGAAGAGCCGATGCCTCGAACATGCGTGATCTCTCTAATTTTGATGATGAGCGGGCT
GATTTCACAGAGGCGCAGCATATCAATGAAGTACACGAACAGCGTAGTAGTGAGTACATCAGCGACGACTTCGTCCAGGTTGAGC