Description :
From Genome Similarity Track
Location :
Scaffold_2524:592- 2380
Transcript NameFunction/comments
Phyta_totarag14583hypothetical protein

Sequence
1788 bases(100 bases per row)
CCTCCGGTCGTCGCCGGGCTCGCGTCGTGTGTCATCGATTCCTTGACCAtccttctctctcttcttgctcgaacCTTGGTTAGCTGGTACCTACCAAAAC
AAGCACACTCCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTAGCAGAACACAAAATTTTCAGATGTGGAATCTTCCtcacaaaccacaacaatcgTCGA
GTTAGGTCGGCGTTGTTAGGCCTGCGCTGGGNGGAGCGAGACACACCCTTCCCGGGTCAACCTTGatctcttggcgctaccagtcaaTACCCTACAAGCT
ATGCCTCTCGGGTATCAACGGCAGACATAATCCAGCCCGTACAGGGACTTACCGGATAGTGtacacttgtcttggacttggaaaatactgctctgtttAT
CTTATATCTTTCGGGAGTCCCGAAGGGttttctcctcctgcttTCCTGTGTTCCTatacaaacatcaagtaCAAATGGAGTGGTTTCGCAACCACTGCGA
CTCTACGCCGAGGTCGCTGGACGACTCTTCAGCTCGGTGACTCGTCAGCTCTGCCACTCTTGGACTCGACGACTGGGCAAAACGACCGAGTACCGTACTT
CACCAGTCCTAAGACTATACTGATCCTATTTTAGGCGATCCTGGTTTAGGTTCGGTCCCAATTTGATgattccctacaccacaGGAGTCCCTTGATCAGC
TGGAATAGCTTCTCGCGGAACTGCGGAGCGACCTTTCGGATCCGTTGGGCTACCGGTTTCGCATTTCCCACGTCGATGTCGCAGATGACTCCTTTCGCGG
CCGGCGGAAAGGCATTGTCTTTCCCAATTAGGAGGTGCCGGCGTCGCCAAATGATCTTCACAAggcgctcgatctcttcgGGCGTACTCTTCGCAGGGTT
CCCCACTTGAATTTCTTCGAACTTGATTTCTTCAGTCGTCGATGTGACTTCCGGCAATACTGTCATGTGCCCTTCAAGATCTTCTGCAAACAGCTCACCT
CCTTCCATGATACACACTTGTTCATCTTCTACGTGGGCTTCCGCGTGAACTTTGGTGAGATTAGTTTATTCTCCTCCAGATCCCGTCTCAGCATCTCTAG
ATTTCTGCCAGTCTCTGTAGGTCAATCTAGGATGCGTTTCTGATTTGTATCCATCTCTGCACCTCGGTCTCTGCAATCACCTGAATGTTGACTTCTGCAA
TCAGTTGCATACTGACATTTACCATCACTTGCATACTGACGTCCCCAATCATCTGCATACTTTGCCCTTTCTGCACCCGCGACTGGATACTTGGTACACT
CATCGATGCTGACCTGTTCTTTCCCAGCCGGCGACCGTGCGGAGTCTTGTCGCGTTTCTTCCGTCGTTGGAACGCCCTCTCGTAGGGTTCTTCGGTCGTG
TTCTCCGCCATCTTGgttgtcgccgctgccgagCATCGCCACTTTTGCCGGTTGCTCTGGCAGTCGGGGCAAGATCGCCATTGGCGTCCTGTAGAGCGGT
CGGTCCATGGCTGGCTCCTGCGGCTCCACGACCTCCGGGAGGTTTTCGTCGGTGTCAGCGTCGACAGTCGCCTGGTAGGCCAGGTTTGCCACTCGGCGTA
CCTGCGCGACCCCACCGAGACATATCCAGGTAAGCGTGGCACTCGATCTCCGGCCAGCCATATTCCAACGTGCATGTTGCAATCCAGTACTAACTTGTGA
TCGCTCGCGTTTGTCAAGTGCAGGTAGCGTGTCTTGCCAGTGCCAACTGTCAGGGTAGGCACCCAGCGATCCCCGCAGGTCACCCACA