Description :
From Genome Similarity Track
Location :
Scaffold_1711:592- 1997
Transcript NameFunction/comments
Phypl_g14012hypothetical protein

Sequence
1405 bases(100 bases per row)
AGGATGTCGAAACAATACCCGGCTACAGCGCCAACATTTGGTTCGAGGCGTGTTGCTGGGTCGTGCCCAAACACCCATGCCATTGAATCGTCCGTGACCC
TGGGCTCAAGATCGCACTGATCTAGCAGCTCGAGTCTCTGGATCAGCGTGAACCGGCTCGCACTCAATGAGCTTATATTTTCGTTTTCACGAAGAGTAGG
TCGCTCGATGACCATTTGGATTTCCTCGACCGAGTTCTCAAGCGATGCGAAGAGCAACAACTCATTTTTTCGAGGAAGAAGGTATCCTGTACTATCAGCC
GATGGTGTATGAACCACGCAGAATTTGCGTGCAGGACGATGCCGATCTTCGCAACTCGATCTTTTACGAGCGCCATGGCTCCGCTACTAGTGGCCACCCA
GGCTACTTGAAGACACTTCTGGCGGTTCAGACAAAGTTTTACTGGTTGCGAATGGATCGGTCGGCCGACGGTTTGAATGTGATTCTAAGGTGGTCCACAC
AAGATATGATGTGGCACACAAATGTGGTGTGCCACACAAAGATGTGTACCACATTGGGCCTCGCTTAGTACGCTACGGTTAACCTATATCAGTAGGTCAA
GCCTCAGCCATTCATTCGGGTACAGTCATTAAAGGACGGTTCACTAATATATACGCAGTTTAAATCTAACCTCGACAATCGCAAGGCTTTGGTTGCAGGA
ACCAGAAGCCATAGGAAAGCAGGGCCTCCTCGTGCGAACAAGACGACAGAGACGCCAGGCGTCTGTCCGGTTAGAAGCTACGCTTCCTCAAGCCAAGGTG
TGTGTGACCCCCGTCANCTACTACATTCAAGTTCTCTTTGAGAATGGAAGACTCCGGGAGTCGGATGCCGTCTCGCCAAGGCTTTCCTCATCGCTCTGAT
GACCACTGGACCACCCTGGAGAAGATGGTCAGCCTTCTAGGCGAATCGGCTTTCGCTGGATTCCCCTCGCTCCctgccgagcagcagaggGCACGAGTGG
AGCGTTTCGACAAGTACGAGTCGTCGCTCATTGCTCATgtcagcgctgcagcgcaggaagctgctcgcgtgACAGTGCGGGCAGAAGCCCAGAGCGCAGC
TCAGTCCGCTGTGCGGGACCCCGCTACGTTCGCTTCGCGACCAGGGTCGACGAAGGCGGTCAAGATGACGGTCCCCAAGTTCGACGGCAAGGAATCGGAC
AGCCTGGTCTTCTGGATccgcgagatcgagatcgCGCTCAGCGCAGGACAGATCTATGATGCAAGATCCCAAGTCGCCTTCGCTCTGTCCAATCTTGGAG
GtcgagcgcgcgcgtggGCCATGGCCAGGGAGACGTCGTCTNGTCCAAAATTGGAGGTCGAGTGCGCGCGTGGGCCATGGCCAGGGAGACGTCGTCTCCT
GGCTT