Description :
From Genome Similarity Track
Location :
contig_124:59196- 66515
Transcript NameFunction/comments
g13514.t1hypothetical protein
g13515.t1hypothetical protein
g13516.t1hypothetical protein
g13517.t1ETI42219.1 hypothetical protein F443_12617 [Phytophthora parasitica P1569

Sequence
7319 bases(100 bases per row)
GCTTACGAGAAATTCTTTAAACTGGTGAAGATGGGTATGCCTGCCGAGCAAGTAAAAATGAAGATGATCGCCGCGGGCTTGAATGCGGACTTGTTGGACA
CGCCAGATGCGCCGTCACCCAACCAGAAGTCAGCTGGCAGTAGTGCTGGCGGCGGTCTTCTTTCAGGACTCCCTCCTCCAACAGAAGCGGTGAAGGTGGA
CCCATCGGCTTTGAAAGCAAGTTTAGCCTCAAAATTAAACAACAAAGCAGCACCCAAGAAGCCCGAGGAGCCTCAGCTGCCGAAGAAGGAAACCGTGAAG
CCGAATGTTGAATTGCGCCCGCTGTTCTGGACCCGCGTGCCTGTAAATGTAGTTAGCAGCACTGTGTGGATGAAACTGAACGACTCGCATGCCGAGATGG
ACGTGGACGAGATGGAGTGGATGTTCCGTAAAAACCCGGTGGACGCGTCGAAAAAGATTGATGAAAAGAAGAAAGAAGCGGAGAAGGTACTGGCACAGCC
CAAGGAAGTACTTTTGTTTGACCCGAAGAGACAGCAAAATGTGTCCATCGCCATTGCTCGGTTTAAGATGTCATCAGAGGATATCAAGAACGCAATTTAT
GCTTTGGACGGGCAGAAACTGGGGTCTGAAGTGCTGAACGTGCTCATTTCTATCTCTCCTACGCTGGAAGAGATTGACATGCTCAAGAATTACGATGGAG
ATGTAAAGCTGCTAGGAAATGTTGAGAAGTTCTTCCTTGATTGCTGACCATTCCGCGCTATACTCAGCGTATCAAGTGCTTCAGGTACAAGTTACAGTTC
GAGAATCGCATCCTCGAAACCCAGGCACAGCTGGATACATTGGTTGCTGCTACGGACCAAGTGGCTGAAAGTGACAAGTTCCGCCGCGTTCTGGAGCACA
TTTTGGCGATCGGCAACTATTTGAATGGTAGCACTCCTCGTGGTGGCGCGTATGGCTTTAAGCTGGACACTCTTATGAAACTGCACACGCTGAAGTCGGT
TGATCCTCGTGTTACCTTAATGCACTTCCTGTTGCGTCAGCTGGAAGAGAAGTCTCCTGATGTCATACTTTCGCTGGAGAAGTTCCCCATATTGTGGAAG
CGAAGAGACTGTCTCTTGATCAACTACGCGCCGATCTGTCGTCCTACAACACCGCTAGCTATGCTGAAGGGCCAAGTGCGTGCGTCCAAGAATGATCACA
TTGAGGGTGACAAGTTTTACGAGGTGATGACTCCGTTTGCAAAGGATGCAGAAGAGGTACTGGAAGAGCTGGGACGCGATTTTAACGGCTTGGAAACTTG
CTATCAAGAGCTTGTCAGCTCCTTTGGTGAAGATCCACGAAAAGTTGGGCCCATGGAATTCTTTAATATCCTGGATGAGTTTGTGACGGAGTTCAAGAAG
GCTTACCGTCAAAATCAGACGAAGGAATATCAAACTATCTATGAGGAGGCTGCAGCGGCGCGTGCTGCTGCTGTGGCTGAGAAGGCTGAGCGATTAAAGC
ACGAGGCCGAAGAACGCCAGCGGCTGGAAGAAGAACGGCAGCAAAACTCGCAGGAGACCAAGGCGATTTATGCCGAAATTATGTCCATCATCACCGCCTG
GGCTGGGAAGCATTCGCCAGGTAACGAAGACGCAGTGATCGAGCAGTTTAAGGAATCATCGCGGAAGTTTGGCTTGGATGAGATCACAGCTGATGAGTTT
TGTGACCAAGTGCGCCAGTGCGTTGGGTCGAAAACGGCAGGTAAAATTATTCCAAATAGTGCGAAGCTTCTGTCCGACGAAGAGAAGCAGAGTGTGCTGC
TAGAGGCGTTTGCTCGATTCAAGGGGCAAGTGAAGAAAGAGAAGGAGTCGAAGAAACAACAACGCAATTCATTGGTGTCCCCACCGTCCGAAGGGCGCGA
GAGGGCGGGGTCCTCATCGGCGGGTCGCAGACGCAACAAGGTCACGGTCCCGCTTCCGATAAAGGACATCGAGCCTGTGGTCGGAGAAGAGGCCCAGCTG
CTTCACAAGTCCATCTTGGAATCTGTGCTGGCGGCGTTTGGTGGCGATCCAAAGAAAATGAAGTCGTTCACGTCCCATACTCGCAAGTATGGCAACGAGC
AGATCACGGCGCACGAGTTCTACCAGTATTTAATGGAATCGTTCGATCCTGACTTTGTTGGACGCCTGGTGCCCGACCTCGCGCGTCTGCTGCAGGATTC
GGAGAAACGCCACGCACTCATTCGAGCATTGTGTGAAAGTGCGCCGGGCTGGGCAAAGTTCGCGGGCCTATAGAATGGCAGCTTCCTGAGGGTTGAGCGA
GAAGGTTGTTCTATCCAGGATTTTGCGAGGCCAGTATGAAAGTGGCTCAATTTATAATGAAGATTACAGAAGTCGTTGCGCATTACAGCGGCTAAATTTT
AGCTTGCTGGGGTCGATGCAACGAGCGGTATTGGAAAGTTTCTTTGATGCTAGTGCTAAGCGCGAAGGCTGTTGGAGCTGCTCTGTTGCGAGAGCGGGAA
ATCGCTGTAGTGCTTAGGCTTGCGCACCGCAGGGTCGGGCAGTGCGCTGCCTTTTTCCTGTTTGGCGCGCCATAGATCCTGCTGGTCCTTGAGACCACGC
ACCCACCGCTTCATGTCGCCTTTGCTCTCGGCGCGCAGGAAGAAGCTGCGCTCGGGGGTCTTGACGACGAAGCTGTACACGCCGTGGTCGCCGTTCTCGA
ACCGCCGGATAGACTCGATGCCAAGGAGGTCAATGACCTTAGATGCTTCTTGCGAGCTTTCGTGCTGGTAGTACTTGAGCCTCATGCCCTCGAGGGCGAA
GAAGCGCTTGTTCCATTGCGGGGTCAACAGCCGCTCCTTGGCCTTCATCTTGAACAGGTAGCCGCTGATGGGAACGGGGCCGCGTTCAGCTGGGGTCTTC
ATGTTCGCCGTGACTTCGTCGTCGACTGGGCAGATGCCGCTTACACAGCGGGTGGCGAAGTGAAAAGTGCTCGGGGGTCAGCGTGCAGGCTATTGCTGGC
AGCAAATTGCTGGCTTGGGCATCTTGTCGCGATGTTGAAGCTCTTTTTTTAGAATCGATTGTTTTAGAATCGCTAACACAAGTTCTATTTTTAGAATGTA
CACAAGCTTGACATAATTTATGTGGCACTTGTGTTGAGATACGCCCGTCGTGGATGCCGCTGACGTCGATGCCAGCGTTGCTGCATATCCTGGCACTGCT
CGCTACTCTGCTGTGTCTGGCCTCCTCCCCGGTCATGGCATCAACTGCTCAACAGCTGACGCTGCGCGTGGAATTGCAGCAGCAGCTCGGACTGCCGGAG
ACGCTGCAGGCTCCGATGACCCTCAGGCTGACAAACGCTCCGGCCTCATTGACAGAGCTGCAAAGTGAGCTCCGTCAGCGGTTAACAGAACGTCTTATGG
AGAATAAAAACAGCGAGCGAGTAGCTGCTGAATTGGAGATGGCGATCGAAGTATATGACCAGAAGATGCAGCAGTTTGTGCCTTCAAAGAGCTCCAACAG
CTCGGACGTCGCTCGAGACTGAGCGTCACGTTCACCAACGCAGATGACCTGTTCCCGGACCATACGTGCCTAGCACTGCCGTCAAGGATCTTTGGGTTTG
ATGCAGCGGAAGGCGGCAAGTTTGCGATCGACGGGAGGGTGGTGCATATTGAGGAGGTGGGCAACTCCGGCAAGGGCACGGGATTGACGACGTGGGACGG
ATCCGTGGTGCTGGCGAAGTATATCGAGCACCAACGACGTGATGATGTCGCTGGGAGCCGAATTGTGGAGCTGGGCGCCGGGACAGGACTAGTAGGCATC
TCTGCTGCGCTGCTCGGAGCACAACAAGTGATCCTGACGGACCTCGACTACGTCGTGGACAACCTCGCCAAGAACGTGGCTGAGACGATGAAACTTGCAG
CTAGTGAAGGCAAACCCGTAGAGAGCGACGTGTCAACGCAAGTGCTCAACTGGTTCGACCCGCCAACGGATTTGGGAGACATCGACTTTTTGCTGGCGTC
GGACGTCGTGTGGGTCGAGGAGCTCATTCCGCCGCTCGTCGCGACGTTCGACGTGTTGCTGCGCCATTCCGCCGTGCAGACGCGAATCCTCATGTCATAC
CAGAAGCGCAGCATCATGTCGGACCGACTGCTCTTCAGCGAGCTCGAGCGTCACAGCCTCGTCAAAACCCGCGTTCCAGCCGCAGCCTTACATCCGGAGT
TTTCCACCGACCGGATCGACGTGTGGGAGATTGAGTGGGGCGCAGCAGAGCGAAGCAACTAGAACGCCGTGGTCGAATAGAGGAACGTGCGGTGCGCGCC
CAAATAACAAAGCCGATGCTGCTTCAACTGGAGGCAACGTAATCTGCATAGCGACGCTGGGCATCCTATCAATGTCGACTGACAAGCAGCGCGTGGTCAA
GTTCAAATCCTACGATAGCACGAGCCCTTGAAAATGTATTTACTTGGGAAATTAATTCTCCACATCTACATTCTCACTTCGTTCGACCTTGCACATTACA
TATTACTGTGAGACATAAACATAGTTAAAGGCCAAAGTTTTCGTGGTGTCTGCTGCAACCGATCTTGGCGCCCGTCGGACGCTGTGCGAGCCATTCGCGT
ACTTGCCCCGTTCCAGCCACAAGATGCTCGGCTTCCTGCGTGCTCCCGCCCGTCGCGCGGCGCTCCTGGCGCGCCGCCACTCCTCCTCCGAGAGCCTGCA
GTGGGCCGCCGCCATGAACAAGCCGCTGGCCGAGTCGGACCCGGAGCTGTTCAACATCATCGAGCTCGAGAAGCAGCGCCAGCGCGACTGCATCAGCCTC
ATCGCGTCCGAGAACTGCACGTCCGTGGCGGTGCTGGACGCGCTGGGCTCCGTCATGTCTAACAAGTACTCGGAGGGCTACCCGGGCGCGCGCTACTACG
GCGGCAACCAGATCATCGACCAGGCTGAGGAGCTCTGCCGCGCGCGCGCCCTCGAGGCCTTCAACCTCGACCCGGAGCAGTGGGGAGTCAACGTGCAGTC
GCTGTCTGGCTCACCCGCCAACTTCCAGGTGTACACGGCGCTGCTGGCGCCGCACGACCGCATCATGGCGCTGGACCTGCCCCACGGCGGCCACCTGTCG
CACGGCTACCAACTCGGCCGCAAGAAGATCTCGGCTACGTCTATCTTCTTCGAGAGCATGCCCTACCGCCTGGACGAGAGCACGGGCCTTATTGACTACG
ACGGACTCGAGAAGACCGCCGGCCTGTTCCGTCCCAAGCTCATTGTGGCCGGTACCAGCGCGTACTCGCGCCACATTGACTACGCGCGGATGCGCGAGAT
CTGTGACCAGCAGGACGCCGTGATGCTCGCTGACATGGCTCACATCAGTGGCTTGGTGGCTGCTGGCGTCGTGCCCTCGCCGTTTGAGTACGCGGATGTG
GTGACCACCACCACGCACAAGTCGCTGCGTGGACCTCGTGGAGCCATGATCTTCTACCGCAAGGGCGTGCACCACGTGGACAAGAAGAGCGGCAAAGAGG
TTTTGTACGACCTTCAGCAGAAGATCGACTTTGCCGTGTTCCCCGGACTCCAGGGCGGACCCCACAACCACACGATCGCAGCGCTGAGCACGGCGCTGCT
GCAGGCGCAGAGCCCGGAGTTCAAGGCGTACCAGTCGCAGGTGATCGCCAACTCCCGGGCCATGGTGGGTGAGCTGATGAAGCGCGGCTACGAGGTGGTC
TCGAACGGCACGGACAACCACCTGGCCCTGGTGGATGTGAAGAAGTCGCGTGGCGTGGATGGCGCCCGCGTTGAGTTTGTGCTCGAGAGCGCCAACATGG
TGGTGAACAAGAACACAGTGCCCGGCGACAAGAGCGCCTTTGTGCCCGGTGGCATTCGCCTTGGTGCCCCTGCGCTGACAACGCGTGGCTGCACGGAGGA
GGACTTCGAACAGGTGGCCGCCTTCATTGACAGCGGTGTGAAGCTCACGGCTGAGCTGAACGAGCGTGCCCGTGGACAAGGAGTGAAGAAGGTGAAGGAC
TTTAAGGCGTTTGTCGCTGATGACGTCGAGGCGAAAGATAGGGTGGATGCACTGAAGGCCGACGTGACGGCGTTTGTGCGCCAGTTCCCGACGATCGGCT
TCAGCGAAGAGGGCATGAAGTACAAGGACTAAAGTGTCCGACAGGCAAAGAAGAGGTTTCGTTGCTGAGTGTATGAATGGCATGACGACCTAGTCTATCC
GATACTGGCTCGGTCCGTCTCCTCTTTGCCCCGAGACTCTCTGCAAGGATGACCAAGAGGGCGATACAAGAAGACGTGGCTGCTTCTGCTCCCTGACATT
GCCATGGAAGGCAGCATGATGGTCTCCTCTTGACCCGTTCTGACGGCACGGAGCTCGCGGCGGCGTGAAGACAGATTGAAATGGAAGTTACGACATTGAA
CAATGAACGACCTGCCTGCCTGTAGTAGACTCAGCTCACACTGATACTTTGCTGCCTCAGTGAGACCCGCTGCACCCATATGAGAGGAAGCACTGAGGGG
TTCACTCTAATTGTTAGTGCTCCTTGGCTTGATTCATGCAGGAACTTGAGGAGCAAACATGTATGGTAACGGACGGAGTGTGCTGCGTTGCTTTTGACGC
CAAGTGTAGCCATTTCCGATAGCTCCCCTGCCAAACCCGATCTCGAGTGACGATCGTGTCGCAGGCACGCAAAAAATCTCACTGGACTGGCAGTTGACTT
GCAGCCAGTATGCCCGGGCTGATGCATGAGGAGCGCCAGGTGGCGGCGGCCGGAATTGCGTGCGGCTCCAAGCTAGGAGCACCGCTCCGAGCAGGCAGTG
ACAGGCCCGCCATTTGGCGCGGTGTCGCCCACGACTGAGGAAAGTGCTCGATAGCGTGCGAGCGACCACAGCCCCCTTTAAGCCGTCCATCCCGATTTAG
TCGGTGCGTACGAAACAGAATTGTAGCGGCTAGCTCTTCAGCCGCACCTTTTATTATGGACCGGCACGTACCGTTCCTCTCGGATAAAGTTTCCATCCTG
TCGTAGGTGACAGATGGCATTCGACGTTCAGTATCGAAGGTTGTACAGTGGCATGACCGTATAAACTTAAGCGGCATTCTGACTAGCTACTGTCTCTTTT
TTTCCAGTATGCATTTTTGGGCTCTTTTGCATTTTTTGGGCACTGGTGAGACCCGATGATCTTCGCGCTCCGAGCAGCCATACGCAAGTCTCGCTAATGC
ATGCACCCTGCAGCACTGCCTGCACTGGCAACAGCAACATTGGCAGCAGCATCATCGTGTTGTCGCGTCGAATTGCTGCCTTTCGAACCGATTCAGCGCT
TCCCACGCCAAATTTATTT