Description :
From Genome Similarity Track
Location :
contig_25:59194- 61347
Transcript NameFunction/comments
g4888.t1hypothetical protein
g4889.t1hypothetical protein PHYSODRAFT_370933, partial
g4890.t1hypothetical protein PHYSODRAFT_514023, partial

Sequence
2153 bases(100 bases per row)
GTGGTGGTGTCAATGACAAAGTCCGCGGCGTCGTTGGCGCCAGTCTCCAACTCAACCGTCGAGAAGGTCAAGCGGTCGCCAGCCTTGGACGTCGAGAACA
CACCCGCCTCGTTCCCCGACAGGTGCAGGTGGCCATTGTAGATAGTATCGCACGTGGCCTCCGAGCACACGCAGACGCCCTCGAGATCCGCCTGGAATCG
GTCCGACCACGACGTGCAGTTGTTCGTCGCAGCATTCGCGGCTTGCAGCGCGAGCAGTGCCAGCGCGTAGCTGAAGGGATTGATAACCAGCATGCTCCGA
CGTTCGGGTGCAGGGTACGTTGTCTCGACCAGGCGAGTTGGGAAATGGTGTGGTCAATGACATTGACCACCACCACCCCGCCCAGAAAGCTCGCGAAAAA
GCGCGCGAGTGTATCCTTGCGAGGCTATAGATCCCACTCGGCGCACTGCACGTGTAGCAGATTCAGCTTCACAGACGAAATTGAAGGCGTTGCACACGCC
ACGCTAAGTGTTTTGGACTCCAGCACTCCATCTACAGGAAACGATGGCCAGAATCAGCTCATTTCGTAATCGATCCGGCAGAAATGATTACCACTGCGGA
GTGTGTCCACTGACACCTACGGTACTTTATTTGATGTCGTATACATAACATAACCCTTTGTAGCTCTCCTAAGGCCTGGAATACAGTAAGCGCTCTCTGT
TCCGGTACCACTTATAAAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACAGCTTCACTTATGGCGGGAATCGCCACGCACCATT
CATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCTCCGCCCCATGGGCTGGATGAGGATAGAGCAGAAGAGAGGTCTTATCAAGAAG
GCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGCTACCTACAAGCTGAAGCGGGCGCCAGCTCAAACAACCATTTCCGACA
TCCTCAAGATGGCCCCGGCAATCATGAGCAAGGCGTATGGGGACGGCAAGCGGCGCTAACCGCTGAAGGTGACCTCGGAGGCGCTGGGAGAGCGCCTATG
GGAGTGGATACAGAAACTAGAGGCGTAGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAGCGCGAGATTTACAAAAGGAGCTATGTGATGCTTGG
GAGCTGTCCTTTTCGGACGGGTGGCTCACTGCATTCGAGCGCAGGCATGGTCTTCGTTCTCGCTCACGACCTGGAGAAGCTGCATCGGTCGACCCTGAAG
TCGTTTGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACCTATACTCTCCCGATGACGTCTACAATATGGACGAGACGGGGCTGTGCTACGCAATGGC
CCCCGCTCGATCGATCTGCACAAAGACATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAAATGCTGATGGATCCGACACGCTGCCGGCAC
TCTTTCTTGGTCACGCAAAGCAGCCCTACTGTCTCAACAAAAGCACGGTGGCACAACTAGGCTTCTCGTACCGCTCGAACAAGAAATCCTGGATGACAGG
ACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCGTGCGAAGGGCCGTCAGATCCTGTTGCTGCTTGACAACGCATCGTCCCACCACTGG
GGCGATATCGTGTGTACTAACGCCCGCGTAGAGTTCCTGCCACCGAATACCACGGCATTCCTACAACCCATGGACGCAGGAATCATCGCCGCGTTCAAGC
GCGCGTACAGGGGAAAGCAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTGTCGACCAGCTACAGACAAT
GTAATGGAGCAAGGAGATCTGGCTCGAACTACAAGGTAAGACCACCATTCAAAACTGTTTCCGCCACACTGGAATAGTTTTTAATGCTGTAGATGAGAGG
GACAAAGAGGACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTCGGGCTTCACAGTTGAGTCTTTAAGTAGCCGACGATAATGCACAGCAA
ATCTTAGGATAGGGTCGGACCACGATACCGGAATTGGGAGCATATGCTGTACT