Description :
From Genome Similarity Track
Location :
Scaffold_40:59193- 61206
Sequence
2013 bases(100 bases per row)
ATCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAAAACACAAAGGCAAGGAAACACACCCGCAAGGCAACCCTACGGCCAGA
TCCACGATCAAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCC
ATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCTCTCCGTTAGTCGGTGTGTGGGCGCAGTTGGTAAGTTGGATCCGGCAATCTCGCATATAATATGC
TGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCAGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAG
GGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGGTCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAG
AGAGGTGGATCCGGATCCGGATCTAGAAGAAAAAATCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCT
AACAAAACAAGGAAAAGTGAAGGCGAAATGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCTAAACCCAACCCCGCTAGTCGAAGAAACG
AGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGGTGGTCCGACAAGG
ATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCAACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGA
ACCGGTAAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGAC
GCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGG
ACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACTGGATCCCTAGTGCGCGACCTTTC
TCCGGTGATGAACTTAACTCTGGCAAAGAGGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGATCTGACACAATCCAGCCACGATC
GAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCACCTCACGGATCCGGTCTCGCCAGTGAACCAGACGACCACAGG
CTCTTCCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGT
GCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAATCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCA
TCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGT
TCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCACGCGTCGGATGCTGAGAAGTGTTT
GACCTTTGCGGATCTGCTAGCGGGGTCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACTAGGATCAAGTGGCCAGAATGCTGCGCAGTTTCCAGA
CCGAGTACTGCGG