Description :
From Genome Similarity Track
Location :
Scaffold_16:59186- 63554
Transcript NameFunction/comments
Phypl_g723hypothetical protein

Sequence
4368 bases(100 bases per row)
TAACGTGGAGACTTGTTTTTAACGGAagggcagcaccacctcgtgctgcagaatATCTTCGGCGAGaggccgctgcagcgcgtccggGTGCATCATGCTG
GCGAtcaggtgctgcagcgagttggAGTATTGTCTGTGGGCGAACGAACGGGTGAGCGAGTCACGTTAGCACCCGTGCGGTCCCAAAGAAGGCGAGAGAG
TATCACAACCGTACCGGAACATGACGAGGTCTCCGTCGCGGATCTTCTGCCACTCTTCGCCGCCACTCGCCAGCGTCGTtccgagcgcgagctcatAGAT
CGTGGCTCCCAGGGCGAATATGTCGCCTGCGCGCAAGTTATTTCGGTTGCCTTCGAGCAGTTCACTGCATTGCGACAAACGATGGAGTGTTAGACCTCGC
CATACATGCGCATGCATGCAACACAGCGCACTTACCGACTAAGATACCGATTGTCGCCCTCGGTGATCTCCATGCTGCCATCGAGGTGAGCAACAGTTCC
CAAGTCGCCCAGCTGCAAGTTGTAAGGTTGCAAATGTTAGCACGATGCCTCAGAGACTTGCCAGATTCGAAACACAAACCTTGAAGACTTCCCCCGGACC
GACCAGGACATTTTGCAGCTTCACGTCCATGTGAACCATCTTCTTGTTGTGCATATCGTAGAGAGCCTGAAGCACGCAACGTTCGTCAGCCACTCTCACA
CGGACCGGATTGGACAATGGCAACGCAGTCGCCTTACCTGAGCAAGATGGCACAAGATCTTGCACAGCGTTTCTTCCGGAACCTTGTGCGGCGCATGCTT
GCTGACTAAGCTAGCTAACGAGCAGCCTTCTAGGTTTTCAAGCTGGATGTAAAGCAAGTCGTCTTCTATCCAAGCGTCGAAATACCGGACGACGTGATTG
CTACTGCTCAGTGCTGCTAGTGCCTGCACCTCCCGTAGGGCGCGCTCTCTGAACACCCATGTCGAACACACGATTAATTCACAGTCGAACACTGAAATGT
ATACCATACCATGTTGAAACGTACGTGTCTGCCTTCCCTCGGAAGtggcgcttgctcttcttcacggcgtATACCCAGCCatcgatcttcttgatgcaCT
TGTACACCTTAGAAAACGACCCCGATCCGATCAACTGCCATACACAATGCAATCCAAGTTAGAACATTCCTAACGGCGACTGCAAACACGCAACCAACGT
ACCCCCAGCTCGGAAAAATCCGACAGATACTTGGAAACAGGCGACCCGTTCTTCGCGCTAACCCACGCCGACGGAAAAGACCGTCGTTTGCGTCTGGaaa
tcttcttcttcccaTCCGACGTCGGCTCGGGTGCGAACGGGTTCACGTAGCTCTCCtccgacaagaaggacgcaGCTTGCTCTCTGCATCAACAACCGAC
GACAACAACCCCATGACACAAAAGGTAGTGAGCAACCCAACGTCTCCACCTCAAGACCCTGCCGATCCACCAAACGCACCCGTTGGGTCTCGCTCTCTTG
GTATTCACCACCACGTTAACCTTGGGCGACCCCGTGTCCATGGACGACTGACTCGAGAGCGACGGCAACCCTTTCCGTGCATGCCGCACGTCCATGTGGG
TCATGTCCTGCGTGAggtcctgcacctgctcctcctggATCAAGTCCGCCGCGCTACTCAGTCTCGGCCGTTTCTTCAGCGGCGAGGGGGTCGTCGGGTT
CGACAATGGGACCACCGGCTGGTCTCGAGGCGTCAAGAAGTCCATGTCGTCCTGGCTGTACTGCTGCATGGGCGTGGCCATCCCCGGCGTGTAGTAGCCC
TGGCTGGTGGGCGGCAGTCCGAAGCGCACGGGCGTGTGCGTGGGCTCCAAGTCGggctcgctgcgctggcTGGAGCAGCCCGTGAAGTCGATTTTCTTGG
GTCTGGGCctcttggcgctgctctcgctggTCTGCGAGGCCAGGAGCATGGGctcctcgctgctctcgtcgtccatcacgtcgtagtcgatgcgcttctg
cacggacagcgcctcctcctctccgtTCTCCATGGCCgcggagctgaagctgttgccCTTGGCCGAAGCCTCGAGAGAGCGCCGAGCCTTGCGCGGCTTG
CTGCCCCCGATCTGCTGGCGCATGCTGCCGGCCGCCGGctgcgagaagaagtcgtggatcgagcgctgcttcttggcgcctCCGCTGAGGGACGGGCCGC
CTCTGGACGCCTGTGACGAGCCGCGCGCCTTGCTTCGCAGCGCGTTGAGCAGCATAACGTTACAGGCTCTGCCAGAGTCTCAAAAAGAGTGGGAAAAGTG
ACATTCGGGCCCATGGCTTTTCCCGCCAAAAAAAGGCAGAGATGGAGGATCCGAAAACAAGGCTTAGTTTCGGGACACACCTTCCTTTTTTGGTGGTCGA
AAAGGGCGCCTGCCTATACTTTCTTGTTGAGGAATGCGAAGGACTTATGCAACCGGCtttgctgcttgctgcgctccttctcctctgcacgctgccgctc
gaggTCGAGCTCGGTGGCTTCTTGAGCTATGCGGGTATGCTCGACGGCCTTTTGCTCCTGGCGgagtcgctcgtgctgctcggcttcTAGCGTGccctcg
gccagcgccaccgtgaCGAGTTCCTAACCGTTAAGCAAGCGATAGTTAGTCGTGTAGTGCTGTCAGGGCTGCAACTGCTAACAAACTTACTTGGAGCCCC
ATGCGATCACCGACGAGACGAACGGGAAGCGGCTTCTGGCCGCGATTGTACTTGGCCGACGTGTAGAACTCGCAGATCTCGCAGTCGCGGAAGACGCGAC
AGAGTCGACACGGCCCGTTCAATGTCTCCGGAGTGCCGCGGCCGAACTTGCGGAACGACTGCTCGTAGGTGTCGTATTGACGCAGAATAGTGGCGTGGTC
GGCGTCAGCTTGGATGGCTCGGAGGTAGtagtcgtccagcacgctgcgAGTATGATGACAAGATGAGACTGCTACATACTGCAGCACAAATAGCAGAACG
GAACGCACCTTTGGATCGAGGTGGGAGGCATGACGACCAGCGTGGCGTCTGCACTGCACTGCACTGTGCCGACTTTGCCAACGTACTTGAAGGCGGAGTA
GACCCCAAACACCTCTACTTGTGCGAAATGGAGAAAGTTTTTGTTTTGCAACTGCACTCGAACGAACTGACCCACCGTGTTGACCGAAGGAAGTATCCAC
TCCGTCATCCGTTTGTTGGTTCGGAAAAGCTCGAACGCGCTTGACTGCACTTTTGCGGCTCGAAGACTACGTCCAAGCATCAGAACTTTACTTGATGAGA
TCGAGTTAGCAGCCAAACTTGCCAAGCAACGCACCCTTCTTTGCCTTCCAGGTCTTTGAATGCGAACTCGCTCACGAAGACCCAGCATGGGAACAGCCGA
CTGCTGTACTCGGACCGGCTTTTCGACGGATTCAACGGTTCATCTGTTCGATTCCATAGCTTTGCATTTACAAGGATTCACAGCATTCAGCGAGACGGGC
ACCCTACAAATGAGATTGAGATTTGCCACCTACCCGAATTTTCTCGATAACTGCAGGTTGCCCGAGGTCTACTTCCCACCACGGCATGTCCTCCACCTGC
ATAACCGAACAGAGCGGAATTATCAGCACAGTATCGCGCAGTGCTCGGAAAGCACCTGCAGTTTGGCAAGTCGTACGTGAGTGTGAATACAAGTGGCTAA
AGCGCCACCGATTTCCCCGTCCACTGCCAAATGAGGTCCCTGCTCGTTGTAGATGGTGATCTGGCGACACGGCTTTCCAAGTGCGAGGTTATACGGCTCC
ACATGCAGACATTTGAGAAGTTCTGGTTTCTCAATAAATGTTCGCTGCATCCAATGCACAAACAATCGCACCTTGTAAGCCCCAACGAGTCAAACCACTA
TGCTTAATGATCACTTACGCTGATTTCATGGCCCGTACAACCATGATAATTGCGACCCCACGTGTAAAGTTCGCCGTACGAAGACACCGCAGCAGTATGA
CTGCCTCCACATGCTACCTGGCGAACGCCAACACCATCTAGCTCTGGTACTCGTTCCCACGATAGCATGTACCGACTCAGAGCAGTCGCGCCTCCACACA
CATAAACCTGACCTCCAAGCAGCTTTTTGCTCCCTCCGCTGAATTCAGACGTAACCTCAGTACTGACTGCTGAATGAGCTGTCCCACAAGATACCTCCCA
TACCCGGACTTTCCTGTTGACGAGATCTCTCACCAGCGTGGGGACAACGATGGTGTCGATTACGTGCGgaccaaggccaagacgTCCACCATTCGCTGAA
CCCCACATGAATAGCTCACCACCCGTCGAGACTGCTCCACTGTGAGAAGCTCCGCACGATACAGATCG