Description :
From Genome Similarity Track
Location :
contig_29:59186- 60541
Transcript NameFunction/comments
g5704.t1ACY1-like metalloprotease

Sequence
1355 bases(100 bases per row)
GCTTTCAAATCGGTTGCTGCAGCAAAAACACAACGCTGGAATGGAACGCCGTAAGTCGCTTTTTGCAACGTCAGCTCTCGCAACGAAAACGGCTACGGAG
CAATCGAGCAACTCGCCCAAGAAGTGCAAGGAAGCCGCTCTCGGCGGCGAGTCATCGCCAAAACTTCAACAACGCAACTTCAGCTGTGAGCATGGTCGAA
TCACGTGCAGGCCCTGTTGGTTTCGAGACTTGGACAATCGGTCCTCGCAGCTCGCTCAGCGCTGTGCCATGTGACTTTGGCAGCCAACTCAGCACCGCGA
TGTAGAGGCGCCTATGATTCCAATGATAAAGCGCTTGGTATGGTGGTCAGTAGCAAAGGCTTTGCCAACTAACACGGACTTCTGTCAGCTTCTTGAAATG
AAGGCTGCTATCTAAGGCATTCTACTTGTGAGCGAACGTGTAGTCTCATAGACCTTGATGCCATGCAGAAAGGAGTATACTATTTGCTGTCCTTCCCTAC
ATCTGAGCTACTGGCAGGCTCGATGGGATCGATACTTCACTTTGCTTCAGCATACGCGAACATGCGGCGGAAGAGCGTCTCGTACACGTCGATGCCACGC
AGGAAGGTGTCCTTGTGCAGACGCTCGTTGTGCTCGTGAAGCAAGATTTCCGTCTTGTTCATCGGAGAGAACCCAGGGCCGGGATGCCGAGCTGGCGAAG
GAAGCGGCTGTCCGTCGCGGCTGGAAACACCTCGGTCTCAACGGGAACACCGACCTCCTGCGGCGCAGAAAACATGGTCAGCTCAATGCGAACGGTGCCG
TTCTCACTACCTGTTCGCTGAGGATGACGACTTACCTCGCACCCTTCCTTGAACAGTCTCCACCAAATGTTGTCGTCGTCGACCGACGTCGTGTAATGCT
CATGCAGCGGGTTTTCCACCACGATACGAACTCCCACGAGAGTCCTTCAGCAGAGCACCATTCATCAAGCATCGTCTGCAATGCGCCAACCAAAGCCACG
TTAGCACGAGACCCGTACGCAGTCCACTCCACGTCCACGACAGAGCGCACCTTGAATTTCTTCAGGTCCATGTTGGGCGAAATGCGGACGTCAAAACCAG
CAACGGCCTCGGTGGGGATGACGTTGAGGGCGTGCGTCTTGCCACCGTCTTGGGACACGCCACTCTGCAGCATGTTGAGATTTACCGTAGTCACATCACC
AAGGTTTCGCTTCTTGATATCGCCGTGCTTGCACCCCGAGTCTGCACTCAATAGAGCTTCTTGCTCCGCGCGAAATGCCAAAGCCTGCAGCAATAAACAA
TTTTCAACACTCGCAGCTCGAAACAGCACGAACTTCGCGTCGGACGTAGAGCACT