Description :
From Genome Similarity Track
Location :
Scaffold_218:5918- 8809
Transcript NameFunction/comments
Phyag_g3603hypothetical protein PHYSODRAFT_262310
Phyag_g3604hypothetical protein PHYSODRAFT_562177
Phyag_g3605hypothetical protein PHYSODRAFT_513613

Sequence
2891 bases(100 bases per row)
GGCTGGCTACGCCAATCCAGAGACGTGCACAGGAACTTGCACCAACGCGCACGACCCGTCCATTATCCGCCGGTCCGACGGAACGTACTTCCGATTCTCC
ACGGGCAACAAAATCGCCATTCACTCGGCCCCAGCGCTCACGGGCCCCTGGAAATACTTGGGCGCTGTGGTCCCTGACGGATCCAAGATCAACCTGAAAG
GCAAAGATGATCTCTGGGTAAGTAGTTCGCGCAATAGACGCTTTCACCAGGGCTGATAAATACTCATATATTGCTTTCTGCTAGGCTCCTGAAGTGAACA
AGGTTGGAGATACGTACTACCTGTACTACTCGGTGAGCTCTTTCGGTACGCAAAACTCTGCTATCGGCCTCACCCAGTCCAAGACTATGGAGCCAGGGTC
ATGGGTTGATGCCGGGAGTGTGGGCATCACAAGCGATGCATCCAAGAAGTACAACGCTATCGACCCGAACCTCATCCAAGTTGGAAGCCAATACTACCTC
AATTTTGGTAGCTACTGGCAAGGTCTCCACCAAACCAAGATGTCGTCACTCCCAACCAAAAGTACCGGGGAAAGCGCGTACCAAATTGCCTTCACCTCGA
ACTACGAAGTCGTGGAAGCTGCCTTCGAGTTTGCCCACAACGGCTACTACtacctcttcttctccaaagGTTCGTGCTGCGGCTACGACAAGACCCGACC
GGCCAAGGGCAAGGAGTACCGCATCCTCGTGTGCCGTTCGAAGAGCCCTACTGAGGGCTTTGTTGACAAGAATGGAGTCGACTGCCGGAACAATGGCGGC
ACGATCGTCCTCGAGTCTCACGACTGGGTCTACGGACCGGGGGGCCAGGGTGTGTACAACGACCCCACGCACGGACCCGTGCTTTACTACCACTACGGTA
AGCTTTGCTATTGTCTCTGCTTCAACTCCGTTTGCTGATGCTAACTCTTTGGTGATGAACGTGACCACGATGTCTATGCAGTGGACACTCGCATTGGCTA
TGCGGATGGTGACAAGCGCTTTGGCTGGAACCAGCTCGACTTTTCGAGTGGATGGCCTACGGTGTAAAACGATCAAACCCTCAAAACCACGTCGCTCAAT
CGCCTTTTAGTGGAGTCGCGATTCCTAGAGGAAATGAAACCTGAAAGATTGGTGTAATACTCCAAAACACCGCGCGGATTTCTGGTTTCTCGCTCATTGT
CTTTGCTTCGCCCAAGTAAGTTCCCCAAGGCCGTGAAACCCAGCAAAAGGTACAGAATGTTACCGTAGCACGCGATCGACGAAGGGCAGCTCGTAGTTTC
GCACGTTCACCGCtgtctccagctccaacatTTCATTATAATTCAGAAGAGCTAAACCTTTTTGAACAACTTGTAGAGGTTTGTGGCAACAGAAAGGagg
tgaaatggtcgcggACCTCGTTCGTAAGTGCCCGAGGGCGGCTACGTTCCCAGCAaaagcaagttgaagtgggaTGCAGAATGCTGGTCGTTTTAACCGG
TCCGCCGAACCGGACCGCTGCCTTTCGTGCGACATTGACAATTTTGCATGTCGTACCAATGTTGCACGAACGAGCCTGACAGCGTGCGGCTCTGAATCGA
CTCGACGGGCAAGGCGAAGCTAagggcagcagcagcagctacagggCAGGCGACGATGGTGAAGCCTGTGGTGAACCCCAACATgaacaagacgctgcgt
gAAGTGGTGGGCCGCTTCGTGGGCGCGGCGCCGCAGCTGTCGCACAAGCAGAAGGTGCAGCGCCTGTACAAGCAgtcgctcaagacgctcgaCTCGTGGG
TCATCGACCGCCGCCTCTGGAACGAGGAGGCCACCAAGATCCGCGCCGAGTTCGACACCAACCGCTCGCTGGACCCGGAGTCTGGGTGCGTCAACTTTTG
TCAATTGGTGAATTGGCGGGCTGCATTCCGGTGGTACTTACCATTTTGTGTCATTTTTTAAATTATTTTTTACTCTAGTCTGGCCAAGCGTCTGGTGCgc
gaggcggaggagaaggtggcccACTACACGCACCCGGACCGCTATATATTCAACTACATGCCCGGCGGCAGTCTCTACATGCGAAACGCGCCCATCCCGC
TGGACGTTTGCTTCCCGGACGGAGAAATCccggacgacgtggagctgtcgcCGCTCGAGGCCATCAACATCGACATGACGCCGCTGCCCGCCAAGGAAAC
GgtcttcgtcgacttctccaagaagGGCTACGACTAAGCGTTCGGCCTACCGGCAGAAAAGACAGGGAAATGTGCTACATCATTGTTGTGCAGGACGGGA
TCGAAGCAATTACAACGAGAGGAGAAAAATCAAGGAAGAACGGGTAAAATGCTGGTGTTTTGTGTGATGTTTTGGGGGTTATTGAGCGCTAGTACAGGGA
GATGCATTGGATTCGCGCTCAGGAGTAGTCGAGCTGGTCGCAGATGCGGGATTTCGTCACCGCAGTGTTCAGGCCGAAGTCGCGGTACCGGAACCCGTTG
AAGGAGTTGGTGAACGTGTTTGGTCGTCCTTGTCGCTCAATGTCGACTTTGAGTTGCGCCTTTTCAGCGCCGATGTCGCGATAGCTTGTGGCGTACAGAG
GATGCTGGCTTTGCGCTTCTGTGATGGCTTTGATGTCGATAGCCTTGGGCATCATCTCCTCTGAACGAAGGGCGAAGTCTTCTGGCGCGGCGACGTCGAC
TTGTCGGATGGTGACGAGGCTGGAAGACTCGATCTCTGATCAGCAGAACAAACAACCACATTAGTGCGGGAGGTTGCGGTGCAGCAATCGACTATAGTAC
GCACCTTTGTGCACTGTGGGCTTGTCCATCCGCTGGCTGAGCTTCAAGCGTTCGTGCGCACGGATACCTTCGCCAAGATCGCTGGATGTCG