Description :
From Genome Similarity Track
Location :
Scaffold_82:5918- 8246
Transcript NameFunction/comments
Hyaar_Emoy2808494conserved unknown protein
Hyaar_Emoy2808495PREDICTED: solute carrier family 35, member E2-like
Hyaar_Emoy2808496Drug/Metabolite Transporter (DMT) Superfamily

Sequence
2328 bases(100 bases per row)
AAAACACACACAAGACGTCAGTTGCAGCCCCCTCGACATCCATTCGATATAAAAAACAATAGCAACGTACAGCAGCGTCAATATTGGCAGGTGACTCGTC
GTTCGGGTCCGAGAGCATGGAAATGACCGACACTAAAATAGACTCAACGCCGAGGATCGGACGCCATCGCTCATCGGCCGTTTCTTGCTGGTTCAAATGG
TCTTCTCCAGGCGGATGCAAGATCGAGATGCACACGACACCGTTTGGGTACACTGGATCCAGACGCAGAACAACGGCACAGTCACTGGCAGAAATAAGAC
ACGCGCTTTCCTATTAACCGCCAATGAGCAGCTTGCAAAGTAAGGCCGAACCGACCATTCGGGTGCCACATCTCCGACTTGAACGTCATCTTGGGCGGCA
TGTTGGGAAAGTCATGGGGAAACTCAAGGGCGGCCTTGAAAAAAGCTCCTTCATACAGCGTATCGGGTGGACCGACGAGCAGAATCTCCCAGTTGAAGAT
ATTTTCGTCGTCCCCTAGACCCACGGAAACGCCCTCGGGCGGGTTGCGACTCATTTCTTAGCATTTACCATACAAAATTGGCGTTAATTCGTCATGTAAA
AGTGTCATGAGTTTGCGTGCTACGCGCTGCGAATCAAGATGCAGCAAGCTGGCACAGCATCAAGAGGGATCAGATGCGTAAAAGTAGAGCTTGACGCACC
TAGAAACTGCCTTCGCAAGAGCTCCTTCGCATAATCCATCGAGCTCGCCATTCGTCGCACTGAGTTTTCGTCGGATTTTTGGCCTTTATTGATAGTGACC
GCGTGGCTACATCGCCCTCGGAGAGCTCAAACGCTGTGATTGGTGAAAATAGTCTAGAACGTTTATTTTTCAGTCAATACAGTGCATCAAATCGAACACG
ACCGCTCGATACACGTAGCACACTACATGCTGGTTATACAGTACGAATAGGGGTCTCTAATACCACGATAAAGCGAAGTGCTGCATTACTTGCCCTTCTC
GACCCGAATCTCAGACAATGCGTTGATCGTGCACGTCGACACAGACACAGGAATAGCAGGGGCAATTTCGGGACCCTTGGCAGCTCGTTTGCTCTCGATA
CGCGAAGCTGCATTGAAGCCATAGACCCCAAAGACCACGAGCGCCATACCGCACCAGTTCAGAACACTCACGTTCTCGCCGTAGCGGTAGATAGAAAGCA
CAATTATCAGTGCACGTTTCACGCAGTTGGCCACGCTGTGTGTTATCGGCGACACCAAACTCATGAGCATGTACGCGAGCGCGCTTTGGATGTAGAAACA
CATACCGTCCAGCACGAGCACGCAGAAGACAAACGCTGCAGAGCGGTCCGTATCGCTGGCTTCAAGCGCTGGCTCAATCGGCATGGACATCCAACTGTAG
GCGATGAACAGGACCTGCATGGCTACTGCAATGATGCTGGTGTAGAACTGCAATTGAGAGGCTCTGCAATACAACCCAAAAGTTGTTAGTCGTCTCAAAC
GCCGAGTCAACCACGGCAGACAAGCACAGCTTGCGCACTTACGTATACGAGCGCATCAGCAATCGCTTTGTCAATACGTTCTGAATGCAATCGGTGCAGT
TCGACATTAGCGCCGCAGTGAACCCGAGGACGTGGAACGAGCTGTCCGACAGACTGCAGAAGACGAGACCCGTTCCAATAGGGATAAGCGAAAAGTTCAC
TCTCCACCCCGTGCGTTGACCCAGCAGAAAATAGGCCAACATAACAGTGAAGAACGGTGCAGACGACTTGATTGTTTCTGTAGAGGCAGCATCCATCAGA
CGTCGAGATTAGCACCATATATTCACCACCTTCTGTGTGTGTTCTCCCTGCAGTATAGTGCCCCACAGCACGCAGACACGTAAACCTCGAAGCTACTTAC
GTGTAAAGGAGACAGCAATGTACTTGAGCGCAGTAAGGCCCAGCAGCACCGTGAGAATGCGGACGCCAGCGAGCAGCACCATTTCCTTGAGTCCGTCACT
CACAACCTTGCGCAAGCTGCGCTTGCAGACTGTCCAGCCCTCTAGATAGAGCTCCAAGCTAAGGCCGCCGAGTACCGACATGCTCAGCTGGGCGAGTGAG
AGCACGTTCGAGTCCACGTGCAGTGTGGTCAACACGTAGCGATTCGTCCAGAGCGTCAGGAGACTGATGACGTACCACCCTGTGCCATTATAATGAAGGT
ATTATCCAGCCACAACATCAGTCATCGCACACTGTAAAATAGAGGTCAACAGAGAGAGAGAAGAAGTAAACGGTACCTGCGATGCAGACGCCGACTTTGC
TCTCGGTGCTGCGCAGTGACAGAACGGG