Description :
From Genome Similarity Track
Location :
Scaffold_1159:5918- 7291
Sequence
1373 bases(100 bases per row)
CCCACGCACACCAGAGCCGAGGCCAGTCACTGATTCGCGCCAACAAAGCCTGGCCTTAGTTGCCGCCGCTATGGGCCCCCCACAACCGCCGCGGCGCGTT
GTCCAGGAGCGCATTAATCGCCGCCGTCGTCGCTGGAATCCTCGCCAGCGCAACAAACATCCGCGTAATCACCAGAAAAACTGATTGGCTAAAAATAAAC
GTTTTCCATTGGTCACAATTACTTTCGTGTTTAGGTGCGTTGTATGGGAGCTTAGGACAGGGCGTGAGCCTAGGAGAAGGTGCGAGCTTATCGAACTGGA
TTTGTAGGGCAGTACGAAACAGTATGTACGATGGAGGGGAAACAAATATGGACACAGAGCTACAAAGCACGGAAGCGAGCCGATGCAATTAGCATGTAAA
TCTATGAAAGCACTAAGAGTCACGGACTCTGTTAGACTCTCTACCTAAAACCGGGCTAAAACACGTAGCATGTCAAAATACAACGTGCATTCGATTCATC
TACGAAATAAACGGGGAGGTGGGTGCTTGGCTGGACCCCGACTGCCCACTGTGAAGCCCGTTGCCATTGTAGAACACGATAACACGGACAACACATATAT
ACTATGCGATCACGATAGCATAGACAGCATACCCACATTGTGGTTGCACGATAGCGCGACAACGCGGTAGATGGAGCCACCACAGGGGTGCGCGGCACAC
AGGTGACAGAAAACTTCGGAAAATCACCCATTGGCGAGGGTACCGGAAATGGAACGCTATCGACCATGAATGATTATGGACACGAAGCCTGTGGAATACA
CGTAAACCCTTGAGAACACGGAATATCTAGCAGCCACGAAAGAGGGTCGTACTACGGGAGCACATGAGACCAAAGGAGCTAGCACACAACCACTAAGCAC
TGTGAGAGAATGAGTTCACAAATCCAGGACAATCACTAAGCAGCCTGGGCCACGGGTGAGCAGGGAACCACGAAGCCAAGAAGATCACGGAAGAGCGCCG
GCCACTGTAGAACATGACATCCAACCTGTAGTACGGGGTAACGGAAGCGTACCAAACAACGATATTATACGGGGCCGGATGAGACTCGGAAAGGTAAGTC
GTTAAGTACACGAAGCTAAGATCTACTGGGTGAACCACGCTCACAAAACACGCGACACCACGAAGCACTAAATTCGTGGGCACCACATCTACAACAAACC
ATGCCACTCCGCCGCGTAGCGGCGGCGAACGGCTAGTCTTAAACTATCAAGGCTAGCACGGTGTCCGTCCGTCCGTCACACGAAACGCACAGATTTTTGA
GCCTTCCCATTGGCTGCCGAGCGGAGCGAAGGCGGCTCTAATTTGTTAAAACTAAATTATGTTGCTTACATAA