Description :
From Genome Similarity Track
Location :
Scaffold_79:59163- 60647
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_79-snap-gene-0.36Myosin

Sequence
1484 bases(100 bases per row)
TCTCTCGCGCCGATACGCGGGCGACGGCGACGACCTCAACGAACTCTTCCTACGCAACCCTCCACGCGACTTCGCCTCGCTGTCGTGCCTAaTTGGCCTC
GAATATCTCCATGAGCCAGCGCTGCTGCACGCACTCAGTGAGCGCTTCGCCGTCGACCGCATCTACACGTCCATTGGGGATATCCTGCTCGCTGTGAACC
CCTTCAAGGATCTCGATCTCTACTCCGATGCTGTCATTAaCCAATACAAGACCGCAATGGTCGCGAGTGTAGCTGCCAATGGCGCGCTCAACCACGAAGa
TGACGACCGCAACGCAGTCCTCCcGCATGTGTTCGCGATCGCAGGCAAAGCGTTTAGTGGTCTCCTcAAGCCCgAGGCCAAGAaCCAGTCGATTCTCGTG
AGTGGCGAAAGTGGTTCTGGCAAGACCGAGTCgACCAAGTTCCTCATGAAGTTCCTCACGTCCGTCGGCCACGATTTCTCTTCTGCTGCGGCTGCTGCCT
CTGGATCTGCGCATGCCGCCGACGACGCGGAGCTCGCGACGGCCGATGATATCCTGCAGATCGGCAAGCGCATTTTGCAGACCAACCCGATCCTCGAGTC
ATTTGGCAACGCTCGCACCATCCGCAATGACAACAGTAGTCGTTTCGGTAAGTTCATCAAGATCCAGTTCGACGCACAGAACCAGATCGTCGGCGCCGAG
ATCGCATCGTATCTCTTGGAAAAGGTGCGTTTGATCCaCCAGTCTCCACAGGAACGtAATTTCCACGTCTTCTACGAACTACTCGAAGGAGCAGAGCCCG
AACTTCTCGCGTCTCTGGGACTTGAACGTGGTGCCAAGTACGAACTGTTGAACTCGTACGGTAGTGCAACAGGACCAGGAGCCAGCAGGGCGATGCTGGC
CAGACGTCGGAGCCCACtcACAGCCCAATACTCGAAGCGGTACCAGGAAACCGTCCAGGCTTTTGAAGACACGGGTGTGGAGACAGAAGAACGCACACAA
ATCTTCCgCATTCTAGCAGCCCTATTGCACCTGGGCAATGTGAACTTTGAGATGCAGCAGgTGGgCAGCTCAGGCGTGCCGGAGgAAGCCGCTACCGTCA
CGGAAAAGAGCTACGCCcATTTCGAAAAGTGTGCAGAACTGCTTGGTATTAGTGTCGACATGCtCGGTTCGCTGCTGCTGACACGGGAGATCACTGCAGG
TAACGATGTTGTGACGCTCAAGCTAAATGCAGAGCAGTCGAAGGATGCCAGTCGATCTTTTGCGAAGGCCATCTACGGACGacTGTTCACTTGGCTGGTG
AGTCGACTGAGTGATGGCATTAACTATCGTGAGTGTTTGGCTCcTCACGAACAAGATGAGATCAAAACGATCGGTATTCTTGATATTTTCGGTTTCGAGA
GTCTCGAATCGAACGGATTCGAGCAGATGTGCATCAACTACGCGAACGagCGTCTTCAAGCGCAATTCAACGAGTTTGTGTTCA