Description :
From Genome Similarity Track
Location :
Scaffold_28:5916- 7400
Transcript NameFunction/comments
Albla_Nc14030800conserved hypothetical protein
Albla_Nc14030810conserved hypothetical protein

Sequence
1484 bases(100 bases per row)
TGATAAAAAATACGCTGCACACTCTTTCTGAATTTGCGTGGAAGCCTGCGGGATTGAATCTTTCATTTTCTACAAAAACTTCGCTTTAACTCGACAAACT
GTTTAATCGCTTTAATACCTTTTTCATTGGGATTGTATGTCGATTAGGCACGTGAGGTTGCAAGTTATCGTCCCTAAATAGGTCTTGTCGACACATCCGA
CAAGAGTAGCGCATTCAAAAGAGACTCAATCTAGAATTGTATTACTTTTGCAAACTCGACTTTCATAACGGTAAAATATAGTCTTTCTATACAGATCTAT
ACATAAACTTGCGCAGGTGCTGAGCTCGTGCGTTACACATTTCGAACCAGATGTTTCTCGCAGTGCGTTCCGCGCCGGACATTAATGCAGCAGCGAGGAG
CTTGACAGCGACGTCCACCACCGTGCGAAAAGCATTTGCCACTTCCTCGATCCTTTTTACTGCATCCACTCACACTGCATGAGCGAACTCCCCCATGCAA
GTAACAGTACCCATTTCGCTGCGTTCCTTTATGACAACCATGATGCAGGCAGCGTTTACCACCACCGTGTGCGCGGCACAAACCCCCGCCTTGAGAGCTC
TTGTTACAGCCGTCATGACTGCATCGTGCGCCACCTCCATGTCCTTTGCATAAGCCATTCGATTGCGCTCGCTTATCACAATTATCGATACGACAAGGCT
TCCCTTTGATCCATCGACCATCTTTATTTAGGAATGTACCAGGTCGACGAATGGTGGTTTTGAGGCCTTCGATGGGCGCTGTCGTCAGCTTTGCTGATAG
AATCGTGAGTGAATCCATTGGGAATAGTGGCTCTATTTCTAAGCTTGTGACGATCGCGTCCAGTAAGGCTCGGTCCTCGAAGACAGAGTAAAGAGGGAAT
TCTCTGTCTGAAGGTGATGATGAGTACTCGTACGGCTCCAAATGCTTCGCATGTAAGCCATAGCATGGTTTGAGTGCATTTCCTGCGGTCTTTGGCATCG
TAAACAAGCCGGGTTCCTTTTTCTGCTCCGGCGAAATAGTCGTTAGCATGGATATGTTGCCTGAATCCCAAGAGGATAAAAGATTTCGTTGAGGACTTGG
AAAGCACGTGGTGTCAATCGGGGACTCTGGTTGTGTGACTTGGACTTGCATTTCGAAGAGGTCGTGTTGGAGTGGTAATAAAATAGCTTTGTCTGTAATG
GATGTAATCTGAAAGAGTGGGTCGAGGTACTCGCAGTGGCGCTTGTGTAGCTTATGTAGCTGGTCCTTCGAATTGAAAAATGAGTTGTATCAAGTGAATT
ATATCAAGTAGAGGTTGAGCTAATCGGGAAAAACGGCGTCTAGAAAGGAAAAGGCCATTGTGCAAAGTCAATAGCTCCGACTGCATTGCTCCATCCAGAT
GTTAACAAAAATTCTTAGCGGTATTACTAATGGAGTTACTTTATACTGAAGAAAAGGCCCGGCCTTTACTCTTCTCCAATAGCA