Description :
From Genome Similarity Track
Location :
Scaffold_1124:5915- 9271
Transcript NameFunction/comments
Phyta_totarag12131hypothetical protein

Sequence
3356 bases(100 bases per row)
CATCCATGCACAAGGTAGAACGGAGTCTCCTTTTGCGGCGTGTCCTGAAAGCTGTTGATCGCGAATACTAGTCGTTCTGCGATCTCATCCCAGTCGTGCT
GTAGCGGACCCTCCTTTACAGACTGCATCACCACCTTTCTTGTTGTCCGTTAGCCTGTGGTCGGTAGCTCAGCGTTGCTCTTGACCTTGATTGCACCATT
TCGGCAAATGATTGGAAGACCTCGCTCATAAAGCGAGGATCTCGGTCGTGGCGAATGAGTGATAGTGCCCCGAAGCGTGGTTTATGCATTCTCCGAATAC
TTGAGCCACCATGAGAGAAGATATATTTGACATGGCTTTAGCAATGATGAATCCAGTGAAAGAGCATTGGAACAGCAAAATCGACGTATGACCGTGTCGA
TACTTCGGTAAGGGTATAAAGAAGCCCATGGACACAATTTGGAACGGTCTCTCAGCCAGAATATTGCCGTGCGAGTACCCTCGGAGTTGCGGTCGACGCT
TGCTCGAACTGCAGTCGGAACACGACTTCACATGCTTCGCACGTCGGCGTGCAGGCCCAATCAGTCGTAATTCAGCTTCACCCGTTGGCACGTCTGGACT
ACACCTTGATATCTGCCTTCTAACGAGTCGTGGCAGTTCTGCAAGACTTCGTTGAATCATAGTTGTCGGTACCACTAGAcgcagcttggcgtcctcGTCT
TGCTCATCGCGCTTCCGACAACTTGTTCCCACGTAGTAGAGCAATCCGTCGTCTGTTAGAATAAACTTGTCGACCGGTTTCCAGGTGTTTCGAGCATCAT
TGGAGCCGAGTTTTTCCACATCACCACGCAACACCAACTTCAGGTTAACTCCTCGGTCAGAGCCTTGGAAATatggcgttgctgctcttcctgcatcGTC
ACTTGGTCAATATCACTCGCGTTTGGCGTTGGTGTTTGCTCAGATCTGGATTGTTGCCTGTCTGGTGAGTTCTCGGTGGTTGCCCTTGTTGGGTCTAGCA
GATCACTTGCGCCGTTCAGCTGGTCAGTCGGATCCTCGTCAGCGAACCTAACACGCTTCTTGTGTGCTTTGCTCTGTCATCGTGTCATCACTGAGACTTC
TCCGTGCTCGGGTCGTACGAAATCAACAAACGTTTGCGTGTTGGCGTAATTCGGGGATCCAGAATCTGAACGAAAGTGTCGGAGCTTGGTTTTgcctcgt
cggcgtcgtcatgAGGAGCCTCATAGATCGTCTCGGGTATTCTGGTCAGACTTGAGAGCTTGGCCTTCCTGTCCGTGCTAAGTACCATATTAGACACCTT
CGTGTTCAGCATTTCGCCTGCTAACGATTCTGCAGCTGTGTTTCATTCCCTGATCACGTGACAGAATTTCGTTGACCGAAGATTCGCTGTAAGTTACTTG
TGGCGGTTCAAAACCATCATCGACGACTCCTTCCGACACGCGATCACCCCTAGTGATTGCTGGATTGCGATTCTCGAGTCAGCAACAACCACCAAGACCT
TGGCAACCTTGGTCCAGAGCTGCTTGTACGCCATTGTTTATACCGGTGTACTCAGCAACGTTTACGGTGGTGGTATTTCTCGAGATAAGCCCTCGCCGCG
ATCACTATCTGCCACTCGGGAAGTCGCCACACATTCCACAAACAGCTACCATATTCTCTGTCTTCGCTGATCCATCGAACGACACAACGAAGCCTCGGTA
GTCTCGAGGTATCCGTGCATACAGGAGGTTGGGGTCCATGGGAACTGTAGGTGATCCTTTAGTCGGCGGTGTCACCAGTGACAGCATATCCTCGAGGTCG
ACGAAATGCGTAATTGTCGACTGCAGGAACTGGGCGAAAGCGCAGTCCGTTTCCTTGACTCGTTGCACCTTTATGTGCCAGGGTGACAGCAATACCGAAA
AATGTACGGCTCGGCCAAAGAGCGATTTCCACTTGTGAACCCACACGAGCGTCGAGGACTGAGTGTACACTTGGAGCGTCCGCCCGACTGGCTGGGTGTA
GCATAGCTTCAGCAATAGCAACAGCGCTAACGCCTCTTTTCCGCAGGGTGAGTTCATCTCGGCATCTTTTAGCACGCGGCCACAGAACGTACCGGGTGCA
ACTTGCCGTCATATTCCTACATCAGCGTAGTGATGAGGGTCCATTCATTGGCAATAGCATCACTTGCATGTCCTTGGTCCGATCAAAGTGCCGGAGAAta
gttgcagcagctacttTCTGCTTGAGCATAGCGAAACTTCGCCGAGCTGTCGTAAGATCACCTCCAGGTCCAAAGTCGCCATCCTTGAGCTGGTAGAACG
CAGCGCCATACACAGCGAAGTCTTGAATGGAATTGCTGTAATAGTTTAGCGCACCCAAGAAGGATTGCATCTCTTCTTGGATTTCGGGAACGATAGCTCG
GTAATAGCAGCAAGCTTCTTCGAGTCTGCTTGAATGCCAGCTGGTGATACCTGATGCGACAGAAAGTCCCCTTTCGAATGGACGAAGATGCATTTCGTGA
AACTTACACTGATTCAACATTCAGCGAAGCGACTTAGTCGACGGCCCAGCGTAGCCAGACAGTCGTCGAACGAAGCACCGCCAAAACCGATATTGTCCAC
GAAAGAATGTGTTCGAACACGCCGACTCGTCCGCTTCTCTGGTCGCAAACATATCGGCAACCGGGTTGTTCAGGAGCTGTGATATCGGATCCATCATCGC
CTAGGCTTCTTGACCAGCTTCAAATGTCGTCCGAGAGTTCGGTACGATGGCAGATAGCTCCGTTGACGCATCGCTGTTGCCACCACGTGACATCTTGGCC
TGATTCTTCACCTCTTGCGTAAGCTTGGCATAATGTGGATAGCCTCCTTTCGGTTGGACAACACCCCACGGCGCGTTATCGACCATGCGCTGATAAATCA
TGGGTGCATTCTTCAGACCGAACGGTATTCACAGCCACTCAAAGTGCCCCAGTGCACAGACAAACCCAGAGATCTTGCGGACCCGCAGGAGCATCATGAT
TGCCCAGAATCCGCTAGCCTCATCAAGCGAGCATAACCATAGGTAGCTCTCCAAATGCGTAAGAAAatcatcgacgacattgCGTATTCCATGATTGCCG
TGATGGCATTCACCATCCTGTAGTCGATGCATAGCCGGATGTCGATGTCGTTCTTTTTCAGCACAATCACGATCGGTGACGCCTACGGACTGTCCGAGAA
TGCGATCAGGACAGCCTTGAGTAGTCATTGTAAGCGCTCGTACAGCTTCTGCAGGTGTCGTAGCGGCACTCGCCGGGCTCGCTGTTTGTTAGGTGCGTGC
CCCTGGACGTCAATGTCATACACGACTCCATGTGCAGGAGGCAGTAGCGCATTTCC